Phenotypic Mutation 'barely'

• Allele: barely
• Mutation Type: splice site
• Chromosome: 10
• Coordinate: 77,384,370 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Itgb2
• Gene Name: integrin beta 2
• Synonym(s): Mac-1 beta, 2E6, Cd18
• Chromosomal Location: 77,366,164-77,401,542 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014] ; PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000000299] [ENSMUSP00000118191] [ENSMUSP00000119657] [ENSMUSP00000137734] [ENSMUSP00000137865]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000000299; Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	6.91e-7	SMART
INB	32	447	1.98e-268	SMART
VWA	126	357	1.25e-1	SMART
internal_repeat_1	459	509	7.99e-5	PROSPERO
EGF_like	535	574	6.81e1	SMART
Integrin_B_tail	622	701	5.53e-22	SMART
transmembrane domain	702	724	N/A	INTRINSIC
Integrin_b_cyt	725	770	1.58e-17	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000118191; Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
INB	1	130	2.21e-8	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000119657; Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
Pfam:Integrin_beta	2	54	7.1e-15	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000137734; Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	6.91e-7	SMART
INB	32	447	1.98e-268	SMART
VWA	126	357	1.25e-1	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000137865; Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PDB:2P28|A	23	49	9e-12	PDB
Blast:PSI	24	49	2e-11	BLAST

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0898
• Is this an essential gene?: Possibly nonessential (E-score: 0.477)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:31 PM by Anne Murray
• Record Created: 2019-01-22 12:02 PM by Bruce Beutler
• Record Posted: 2019-02-08
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008404; MGI: 96611

Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(3) Chemically induced (other)(1) Targeted(9)

Phenotypic Description

Figure 1. Barely mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The barely phenotype was identified among G3 mice of the pedigree R0217, some of which showed increased frequencies of B1b cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased B1b cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R0217. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Itgb2: a G to T transversion at base pair 77,548,536 (v38) on chromosome 10, or base pair 18,208 in the GenBank genomic region NC_000076 within intron 5, 10-base pairs from exon 6 (out of 16 total exons). Linkage was found with a recessive model of inheritance (P = 0.000254), wherein three variant homozygotes departed phenotypically from 10 homozygous reference mice and 16 heterozygous mice (Figure 2).  

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is not predicted to affect splicing. If the mutation does affect splicing, the most likely aberrant splicing will result in the use of a cryptic site in intron 5. The resulting transcript would have a 54-base pair insertion of intron 5, which would cause a frame-shifted protein product beginning after amino acid 167 of the protein (normally 770 amino acids long) and termination after the inclusion of 34 aberrant amino acids.

C57BL/6J:

<--exon 5 <--intron 5 exon 6--> exon 7--> 580 ……TCTGGCCGCATCG ……taccatgtacccttag GCTTTGGGTCG…… GAGGAAATTGGC…… 163 ……-S--G--R--I--                    G--F--G--S-…… -E--E--I--G-……

The acceptor splice site of intron 5 is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain structure of α and β integrins. Some α subunits do not contain an I domain. The β-propeller and I-like domains make numerous contacts in the native integrin dimer. The location of the barely mutation is designated. This image is interactive. Click on the other mutations found in CD18 to view more information. Click on the mutations for more specific information. Abbreviations: HD, hybrid domain; TM, transmembrane domain.

The Itgb2 gene encodes the integrin β2 protein (also called CD18), which forms noncovalently linked dimers with integrin α subunits to form functional integrin receptors. The extracellular domains of integrin α and β subunits are >940 and >640 residues, respectively, but the intracellular domains are much shorter, about 50 residues. The shape of the integrin receptor extracellular domain, as determined by electron microscopy, is a globular ligand-binding headpiece connected to two long stalk regions, connected to the transmembrane and C-terminal cytoplasmic domains. Integrin β2 is a cysteine-rich single pass transmembrane protein with six N-linked extracellular glycosylation sites (Figure 3) [reviewed in (1)]. The N-terminal cysteine-rich region (residues ~1-50) of the integrin β2 extracellular domain is called a PSI (plexins, semaphorins, integrins) domain, and shares homology with the membrane proteins plexins, semaphorins and the c-met receptor. Residues ~100-340 contain a von Willebrand factor-type A domain of 241 amino acids, which is referred to as the inserted (I) domain in α subunits and I-like domain in β subunits. The C-terminal portion of the extracellular domain is the “stalk” region, which contains four EGF-like domains (integrin-EGF, I-EGF) and a tail domain connecting it to the membrane.

The barely mutation is not predicted to affect splicing.

For more information about Itgb2, please see the record for Joker.

Putative Mechanism

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. The β2-containing integrins are αLβ2 (CD11aCD18; also called leukocyte function-associated antigen 1, LFA-1), αMβ2 (CD11bCD18; also called MAC-1), αXβ2 (CD11cCD18; also called p150,95) and αDβ2 (CD11dCD18). The CD11/CD18 integrins are referenced collectively as the “leukocyte” integrins, and mediate leukocyte adhesion during inflammatory responses to infections and also during wound repair.

Two integrin β2 mutant mice have been developed. One strain contains a hypomorphic allele (Itgb2^tm1Bay) of integrin β2 (2). These animals exhibit elevated total numbers of leukocytes, including granulocytes and lymphocytes, as well as an impaired inflammatory response to intraperitoneal injection of thioglycolate medium (slightly fewer numbers of neutrophils migrate into the peritoneal cavity). The second integrin β2 mutant strain contains a null allele (Itgb2^tm2Bay) (3), and exhibits a phenotype very similar to that of human patients with leukocyte adhesion deficiency (LAD, OMIM #116920), an autosomal recessive disorder characterized by leukocytosis (especially neutrophilia), failure to recruit leukocytes to sites of infection, recurring bacterial and fungal infections involving the skin and mucosa, impaired wound healing, and lack of pus formation.

Barely mice display a phenotype distinct from that of the CD18 null or hypomorphic mutant, and from humans with LAD. In particular, barely mice do not develop the dermatitis or facial/submandibular inflammation observed in CD18^-/- mice. Spontaneous infections have not been observed in barely mice, as they are in the CD18 null mutant and in LAD patients.

Primers

PCR Primer
barely_pcr_F: TTGCACCACACGCTCAGCTATC
barely_pcr_R: TGCTTGCCGACCTCTGTCTGAAAC

Sequencing Primer
barely_seq_F: CTCCCTTGTTTGAGAAACTGAG
barely_seq_R: ACATGGGTTCCTCAGCTTCT

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 412 nucleotides is amplified (chromosome 10, + strand):

1   ttgcaccaca cgctcagcta tcatgttcac acaaccatca tcttgctttc tcccttgttt
61  gagaaactga ggcttggtcc ttagtccact ggaaggttca ctgtcatgcc tggagccctg
121 cctgctgcct tgtccctgtg ccctccagcc tctgttgtat atcccttgga ctccaggtct
181 tcccagtcct ggtgtctgct tctgtctgct gtccccctgc ctcataccat gtacccttag
241 gctttgggtc gtttgtggac aagacggtgc tgccttttgt taacacccat cctgagaagc
301 tgaggaaccc atgtcccaac aaggagaagg cctgccagcc cccatttgcc tttcggcacg
361 tgctcaagtt aaccgacaac tccaaccagt ttcagacaga ggtcggcaag ca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Springer, T. A., and Wang, J. H. (2004) The Three-Dimensional Structure of Integrins and their Ligands, and Conformational Regulation of Cell Adhesion. Adv Protein Chem. 68, 29-63.

  2. Wilson, R. W., Ballantyne, C. M., Smith, C. W., Montgomery, C., Bradley, A., O'Brien, W. E., and Beaudet, A. L. (1993) Gene Targeting Yields a CD18-Mutant Mouse for Study of Inflammation. J Immunol. 151, 1571-1578.

  3. Scharffetter-Kochanek, K., Lu, H., Norman, K., van, N. N., Munoz, F., Grabbe, S., McArthur, M., Lorenzo, I., Kaplan, S., Ley, K., Smith, C. W., Montgomery, C. A., Rich, S., and Beaudet, A. L. (1998) Spontaneous Skin Ulceration and Defective T Cell Function in CD18 Null Mice. J Exp Med. 188, 119-131.