Phenotypic Mutation 'barely' (pdf version)
Allelebarely
Mutation Type splice site
Chromosome10
Coordinate77,548,536 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Itgb2
Gene Name integrin beta 2
Synonym(s) Mac-1 beta, Cd18, 2E6
Chromosomal Location 77,530,252-77,565,708 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008404; MGI: 96611

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000000299] [ENSMUSP00000118191] [ENSMUSP00000119657] [ENSMUSP00000137734] [ENSMUSP00000137865]
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000118191
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
INB 1 130 2.21e-8 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000119657
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
Pfam:Integrin_beta 2 54 7.1e-15 PFAM
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Predicted Effect probably benign
Meta Mutation Damage Score 0.0898 question?
Is this an essential gene? Possibly nonessential (E-score: 0.324) question?
Phenotypic Category Unknown
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(3) Chemically induced (other)(1) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
fresh UTSW 10 77556161 missense probably damaging 0.98
joker UTSW 10 77549849 intron probably benign
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
Only_just UTSW 10 77549968 missense possibly damaging 0.80
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 critical splice donor site probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
R7305:Itgb2 UTSW 10 77548564 missense probably damaging 1.00
R7574:Itgb2 UTSW 10 77560158 missense probably benign 0.18
R7606:Itgb2 UTSW 10 77556161 missense probably damaging 0.98
R7772:Itgb2 UTSW 10 77561112 missense probably benign
R7888:Itgb2 UTSW 10 77564644 missense probably benign 0.00
R8716:Itgb2 UTSW 10 77557953 missense not run
Z1176:Itgb2 UTSW 10 77557962 missense probably benign 0.01
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:31 PM by Anne Murray
Record Created 2019-01-22 12:02 PM by Bruce Beutler
Record Posted 2019-02-08
Phenotypic Description

Figure 1. Barely mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The barely phenotype was identified among G3 mice of the pedigree R0217, some of which showed increased frequencies of B1b cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased B1b cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R0217. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Itgb2: a G to T transversion at base pair 77,548,536 (v38) on chromosome 10, or base pair 18,208 in the GenBank genomic region NC_000076 within intron 5, 10-base pairs from exon 6 (out of 16 total exons). Linkage was found with a recessive model of inheritance (P = 0.000254), wherein three variant homozygotes departed phenotypically from 10 homozygous reference mice and 16 heterozygous mice (Figure 2).  

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is not predicted to affect splicing. If the mutation does affect splicing, the most likely aberrant splicing will result in the use of a cryptic site in intron 5. The resulting transcript would have a 54-base pair insertion of intron 5, which would cause a frame-shifted protein product beginning after amino acid 167 of the protein (normally 770 amino acids long) and termination after the inclusion of 34 aberrant amino acids.

 

C57BL/6J:

          <--exon 5        <--intron 5 exon 6-->     exon 7-->
580 ……TCTGGCCGCATCG ……taccatgtacccttag GCTTTGGGTCG…… GAGGAAATTGGC……
163 ……-S--G--R--I--                    G--F--G--S-…… -E--E--I--G-……

 

The acceptor splice site of intron 5 is indicated in blue lettering and the mutated nucleotide is indicated in red.

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain structure of α and β integrins. Some α subunits do not contain an I domain. The β-propeller and I-like domains make numerous contacts in the native integrin dimer. The location of the barely mutation is designated. This image is interactive. Click on the other mutations found in CD18 to view more information. Click on the mutations for more specific information. Abbreviations: HD, hybrid domain; TM, transmembrane domain.

The Itgb2 gene encodes the integrin β2 protein (also called CD18), which forms noncovalently linked dimers with integrin α subunits to form functional integrin receptors. The extracellular domains of integrin α and β subunits are >940 and >640 residues, respectively, but the intracellular domains are much shorter, about 50 residues. The shape of the integrin receptor extracellular domain, as determined by electron microscopy, is a globular ligand-binding headpiece connected to two long stalk regions, connected to the transmembrane and C-terminal cytoplasmic domains. Integrin β2 is a cysteine-rich single pass transmembrane protein with six N-linked extracellular glycosylation sites (Figure 3) [reviewed in (1)]. The N-terminal cysteine-rich region (residues ~1-50) of the integrin β2 extracellular domain is called a PSI (plexins, semaphorins, integrins) domain, and shares homology with the membrane proteins plexins, semaphorins and the c-met receptor. Residues ~100-340 contain a von Willebrand factor-type A domain of 241 amino acids, which is referred to as the inserted (I) domain in α subunits and I-like domain in β subunits. The C-terminal portion of the extracellular domain is the “stalk” region, which contains four EGF-like domains (integrin-EGF, I-EGF) and a tail domain connecting it to the membrane.

 

The barely mutation is not predicted to affect splicing.

 

For more information about Itgb2, please see the record for Joker.

Putative Mechanism

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. The β2-containing integrins are αLβ2 (CD11aCD18; also called leukocyte function-associated antigen 1, LFA-1), αMβ2 (CD11bCD18; also called MAC-1), αXβ2 (CD11cCD18; also called p150,95) and αDβ2 (CD11dCD18). The CD11/CD18 integrins are referenced collectively as the “leukocyte” integrins, and mediate leukocyte adhesion during inflammatory responses to infections and also during wound repair.

 

Two integrin β2 mutant mice have been developed. One strain contains a hypomorphic allele (Itgb2tm1Bay) of integrin β2 (2). These animals exhibit elevated total numbers of leukocytes, including granulocytes and lymphocytes, as well as an impaired inflammatory response to intraperitoneal injection of thioglycolate medium (slightly fewer numbers of neutrophils migrate into the peritoneal cavity). The second integrin β2 mutant strain contains a null allele (Itgb2tm2Bay(3), and exhibits a phenotype very similar to that of human patients with leukocyte adhesion deficiency (LAD, OMIM #116920), an autosomal recessive disorder characterized by leukocytosis (especially neutrophilia), failure to recruit leukocytes to sites of infection, recurring bacterial and fungal infections involving the skin and mucosa, impaired wound healing, and lack of pus formation.

 

Barely mice display a phenotype distinct from that of the CD18 null or hypomorphic mutant, and from humans with LAD. In particular, barely mice do not develop the dermatitis or facial/submandibular inflammation observed in CD18-/- mice. Spontaneous infections have not been observed in barely mice, as they are in the CD18 null mutant and in LAD patients.

Primers PCR Primer
barely_pcr_F: TTGCACCACACGCTCAGCTATC
barely_pcr_R: TGCTTGCCGACCTCTGTCTGAAAC

Sequencing Primer
barely_seq_F: CTCCCTTGTTTGAGAAACTGAG
barely_seq_R: ACATGGGTTCCTCAGCTTCT
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 412 nucleotides is amplified (chromosome 10, + strand):


1   ttgcaccaca cgctcagcta tcatgttcac acaaccatca tcttgctttc tcccttgttt
61  gagaaactga ggcttggtcc ttagtccact ggaaggttca ctgtcatgcc tggagccctg
121 cctgctgcct tgtccctgtg ccctccagcc tctgttgtat atcccttgga ctccaggtct
181 tcccagtcct ggtgtctgct tctgtctgct gtccccctgc ctcataccat gtacccttag
241 gctttgggtc gtttgtggac aagacggtgc tgccttttgt taacacccat cctgagaagc
301 tgaggaaccc atgtcccaac aaggagaagg cctgccagcc cccatttgcc tttcggcacg
361 tgctcaagtt aaccgacaac tccaaccagt ttcagacaga ggtcggcaag ca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, and Bruce Beutler