Phenotypic Mutation 'Deposuit'

• Allele: Deposuit
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 72,138,048 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Jak3
• Gene Name: Janus kinase 3
• Chromosomal Location: 72,129,027-72,143,221 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000060073] [ENSMUSP00000105639] [ENSMUSP00000105640]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000060073; Gene: ENSMUSG00000031805; AA Change: E833G

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000051995)
• SMART Domains: Protein: ENSMUSP00000105639; Gene: ENSMUSG00000031805; AA Change: E833G

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000110012)
• SMART Domains: Protein: ENSMUSP00000105640; Gene: ENSMUSG00000031805; AA Change: E833G

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000110013)
• Meta Mutation Damage Score: 0.8361
• Is this an essential gene?: Possibly essential (E-score: 0.664)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:31 PM by Anne Murray
• Record Created: 2019-01-22 12:22 PM by Bruce Beutler
• Record Posted: 2019-02-01
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

Alleles Listed at MGI

All Mutations and Alleles(30) : Chemically induced (ENU)(6) Chemically induced (other)(1) Gene trapped(14) Spontaneous(2) Targeted(5) Transgenic (2)

Phenotypic Description

Figure 1. Deposuit mice exhibit reduced frequencies of peripheral NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Deposuit phenotype was identified among G3 mice of the pedigree R4897, some of which showed reduced NK T cell frequencies in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced NK T cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 74 mutations (X-axis) identified in the G1 male of pedigree R4897. Raw phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. The NK T cell phenotype was linked to a mutation in Jak3: an A to G transition at base pair 71,685,404 (v38) on chromosome 8, or base pair 9,022 in the GenBank genomic region NC_000074 encoding Jak3. Linkage was found with an additive model of inheritance (P = 9.142 x 10^-6), wherein six variant homozygotes and 16 heterozygous mice departed phenotypically from seven homozygous reference mice (Figure 2).

The mutation corresponds to residue 2,708 in the mRNA sequence NM_010589 within exon 19 of 25 total exons.

2692 AACTTTGGCAGCGTGGAGCTGTGCCGCTATGAC 828  -N--F--G--S--V--E--L--C--R--Y--D-

The mutated nucleotide is indicated in red. The mutation results in a glutamic acid to glycine substitution at position 833 (E833G) in the JAK3 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.997).

Protein Prediction

Figure 3. Domain structure of JAK3. The Deposuit mutation results in a glutamic acid to glycine substitution at position 833. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive. Other mutations found in JAK3 are noted in red. Click on each mutation for more information.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 3; reviewed in (1)]. The JH1 region is the kinase domain (amino acids 818-1091), the JH2 domain corresponds to the pseudokinase domain (amino acids 517-773), the JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460), and the JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254).

The Deposuit mutation results in a glutamic acid to glycine substitution at position 833 (E833G) in the JAK3 protein; Glu833 is within the kinase domain.

Please see the record mount_tai for more information about Jak3.

Putative Mechanism

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γ_c receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γ_c receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in natural killer (NK) cell differentiation, IL-4 functions in B-cell maturation and isotype switching (2). JAK3 mutations result in defective γ_c receptor-associated signaling and subsequent defects in lymphocyte development (2;3). Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [T⁻B⁺NK^- SCID; OMIM: #600802; (4-6); reviewed in (2)]. Patients with T⁻B⁺NK^- SCID do not have T or NK cells, but have normal to elevated numbers of immature nonfunctional B lymphocytes (5;6). Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity.  Jak3 knockout (Jak3^-/-) mice have reduced numbers of T, B, γδ T, and NK cells (7-11). B cell maturation in the Jak3^-/- mice is blocked at the pre-B stage, leading to a reduced frequency of IgM⁺ B cells (10).

The immune phenotype observed in the Deposuit mice indicates loss of JAK3-associated function.

Primers

PCR Primer
Deposuit_pcr_F: AGTCCTCGAGATGAGCTGTG
Deposuit_pcr_R: CATGGGAGTTAACGACCTTGTTC

Sequencing Primer
Deposuit_seq_F: CGAGATGAGCTGTGCGGTG
Deposuit_seq_R: GGAGTTAACGACCTTGTTCAACAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 463 nucleotides is amplified (chromosome 8, + strand):

1   agtcctcgag atgagctgtg cggtggcgcc cagctctatg cctgccagga ccccgccata
61  ttcgaggaga gacaccttaa gtacatctct ttgctgggca aggtgagtgg gcgggcatgt
121 gggggaggaa cgtgggtggg tggatgggtc aggtggacac tgccctctca tcctcccaca
181 gggcaacttt ggcagcgtgg agctgtgccg ctatgacccc ctgggggaca atacgggacc
241 cctggtggca gtgaaacagc tacagcacag cgggccagac cagcagaggg acttccagcg
301 ggagattcag atccttaagg ctctgcacag cgacttcatc gtcaagtacc ggggagtcag
361 ctatgggcca ggtgagcggc agcagcatct cgggaacggg ttcgagtccc gcttctaccc
421 tttcccagta gggccctgtt gaacaaggtc gttaactccc atg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wu, W., and Sun, X. H. (2012) Janus Kinase 3: The Controller and the Controlled. Acta Biochim Biophys Sin (Shanghai). 44, 187-196.

  2. Notarangelo, L. D., Mella, P., Jones, A., de Saint Basile, G., Savoldi, G., Cranston, T., Vihinen, M., and Schumacher, R. F. (2001) Mutations in Severe Combined Immune Deficiency (SCID) due to JAK3 Deficiency. Hum Mutat. 18, 255-263.

  3. Thomis, D. C., and Berg, L. J. (1997) The Role of Jak3 in Lymphoid Development, Activation, and Signaling. Curr Opin Immunol. 9, 541-547.

  4. Candotti, F., Oakes, S. A., Johnston, J. A., Giliani, S., Schumacher, R. F., Mella, P., Fiorini, M., Ugazio, A. G., Badolato, R., Notarangelo, L. D., Bozzi, F., Macchi, P., Strina, D., Vezzoni, P., Blaese, R. M., O'Shea, J. J., and Villa, A. (1997) Structural and Functional Basis for JAK3-Deficient Severe Combined Immunodeficiency. Blood. 90, 3996-4003.

  5. Macchi, P., Villa, A., Giliani, S., Sacco, M. G., Frattini, A., Porta, F., Ugazio, A. G., Johnston, J. A., Candotti, F., and O'Shea, J. J. (1995) Mutations of Jak-3 Gene in Patients with Autosomal Severe Combined Immune Deficiency (SCID). Nature. 377, 65-68.

  6. Russell, S. M., Tayebi, N., Nakajima, H., Riedy, M. C., Roberts, J. L., Aman, M. J., Migone, T. S., Noguchi, M., Markert, M. L., Buckley, R. H., O'Shea, J. J., and Leonard, W. J. (1995) Mutation of Jak3 in a Patient with SCID: Essential Role of Jak3 in Lymphoid Development. Science. 270, 797-800.

  7. Nosaka, T., van Deursen, J. M., Tripp, R. A., Thierfelder, W. E., Witthuhn, B. A., McMickle, A. P., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1995) Defective Lymphoid Development in Mice Lacking Jak3. Science. 270, 800-802.

  8. Park, S. Y., Saijo, K., Takahashi, T., Osawa, M., Arase, H., Hirayama, N., Miyake, K., Nakauchi, H., Shirasawa, T., and Saito, T. (1995) Developmental Defects of Lymphoid Cells in Jak3 Kinase-Deficient Mice. Immunity. 3, 771-782.

  9. Baird, A. M., Thomis, D. C., and Berg, L. J. (1998) T Cell Development and Activation in Jak3-Deficient Mice. J Leukoc Biol. 63, 669-677.

  10. Thomis, D. C., Gurniak, C. B., Tivol, E., Sharpe, A. H., and Berg, L. J. (1995) Defects in B Lymphocyte Maturation and T Lymphocyte Activation in Mice Lacking Jak3. Science. 270, 794-797.

  11. Eynon, E. E., Livak, F., Kuida, K., Schatz, D. G., and Flavell, R. A. (1999) Distinct Effects of Jak3 Signaling on Alphabeta and Gammadelta Thymocyte Development. J Immunol. 162, 1448-1459.