Phenotypic Mutation 'Ghoulish' (pdf version)
AlleleGhoulish
Mutation Type missense
Chromosome8
Coordinate111,322,748 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Mlkl
Gene Name mixed lineage kinase domain-like
Synonym(s) 9130019I15Rik
Chromosomal Location 111,311,797-111,338,177 bp (-)
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001310613 (isoform 1) NM_029005 (isoform 2); MGI:1921818

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000055521] [ENSMUSP00000113718]
PDB Structure Structure of MLKL [X-RAY DIFFRACTION]
Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: S248P

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000056157)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: S248P

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000120432)
Meta Mutation Damage Score 0.8982 question?
Is this an essential gene? Probably nonessential (E-score: 0.074) question?
Phenotypic Category
Phenotypequestion? Literature verified References
LPS-induced Necroptosis - decreased 22265413
Macrophage necroptosis: low 22265413
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.58; ML prob: 0.552; human score: -0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(3) Endonuclease-mediated(3) Gene trapped(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
mecro UTSW 8 111319716 critical splice donor site probably null
necro UTSW 8 111312100 intron probably benign
secro UTSW 8 111315567 intron probably benign
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0497:Mlkl UTSW 8 111327873 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1733:Mlkl UTSW 8 111322748 missense probably damaging 1.00
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
R7052:Mlkl UTSW 8 111319442 missense possibly damaging 0.65
R7155:Mlkl UTSW 8 111319403 missense probably damaging 1.00
R7459:Mlkl UTSW 8 111333530 missense probably benign 0.36
R7728:Mlkl UTSW 8 111333619 missense probably damaging 1.00
R8036:Mlkl UTSW 8 111333454 missense probably damaging 1.00
R8064:Mlkl UTSW 8 111312068 missense probably benign 0.38
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:30 PM by Anne Murray
Record Created 2019-01-22 12:46 PM by Bruce Beutler
Record Posted 2019-02-08
Phenotypic Description

Figure 1. Ghoulish mice exhibited resistance to necroptosis in response to TLR4 ligand, LPS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Ghoulish phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1733, some of which exhibited resistance to lipopolysaccharide (LPS)-induced necroptosis (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of resistance to necroptosis after LPS stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R1733. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. The necroptosis phenotype was linked by continuous variable mapping to a mutation in Mlkl: a T to C transition at base pair 111,322,748 (v38) on chromosome 8, or base pair 15,709 in the GenBank genomic region NC_000074. Linkage was found with an additive model of inheritance, wherein two variant homozygotes and seven heterozygous mice departed phenotypically from five homozygous reference mice with a P value of 0.000130 (Figure 2).

 

The mutation corresponds to residue 1,126 in the mRNA sequence NM_001310613 within exon 5 of 11 total exons.

 

1111 ATGAAGAAATTCGATTCTCCCAACATCTTGCGT

243  -M--K--K--F--D--S--P--N--I--L--R-

 

The mutated nucleotide is indicated in red. The mutation results in a serine to proline substitution at position 248 (S248P) in the MLKL protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.999).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain organization of MLKL. MLKL has an N-terminal four-helical bundle (amino acids 1-130) followed by a two-helix linker (termed brace; amino acids 131-170) that tethers the N-terminus to a pseudokinase domain (amino acids 171-464). The secro mutation is within intron 8. This image is interactive. Other MLKL mutations are noted in red. Click on each mutation for more information.

Mlkl encodes mixed lineage kinase domain-like (MLKL), a pseudokinase and member of the protein kinase superfamily. MLKL has a pseudokinase domain (amino acids 171-464), but does not exhibit kinase activity (1) (Figure 3). Similar to kinases, MLKL has a (Val-Ala-Ile-Lys) motif, which positions the α- and β-phosphates of ATP during phosphoryl transfer, but does not have a catalytic loop or an activation loop. The pseudokinase domain has a kinase fold with N- and C-lobes (1-3). The N-lobe has an antiparallel, five-stranded β-sheet and an α-helix (helix αC), whereas the C-lobe contains seven α-helices and a pair of β-strands (4). MLKL has an N-terminal four-helical bundle (amino acids 1-130) followed by a two-helix linker (termed brace; amino acids 131-170) that tethers the N-terminus to a pseudokinase domain (1).

 

The Ghoulish mutation results in a serine to proline substitution at position 248 (S248P); Ser248 is within the pseudokinase domain.

 

For more information about Mlkl, please see the record for necro.

Putative Mechanism

Necroptosis is a pro-inflammatory form of cell death regulated by the kinases RIP1 and RIP3. Necroptosis occurs after stimulation of the DNA receptor, DNA-dependent activator of interferon regulatory factors (DAI), or activation of death receptors [e.g., TNF receptor 1 (TNFR1; see the record PanR1 for information about TNF) and Fas (see the record for cherry)], Toll-like receptors [TLRs; e.g., TLR3 and TLR4 (see the record for lps3)], T-cell antigen receptor (TCR), or interferon receptor [IFNAR1 (see the record for macro-1) and IFNAR2 (see the record for macro-2)] signaling. During necroptosis, RIP3 binds RIP1 through their respective RIP homotypic interaction motif domains, forming the necroptosome. RIP1 and RIP3 phosphorylation in the necroptosome leads to the recruitment of MLKL (5;6). MLKL is essential for necroptosis (2;4-6). Inhibition of MLKL function using necrosulfonamide prevents necrosome formation and subsequent necropototic signaling (5;6). Mouse dermal fibroblasts (MDFs), mouse embryonic fibroblasts (MEFs), and bone-marrow-derived macrophages (BMDMs) derived from the Mlkl-/- mice were resistant to TNF-induced necroptotic cell death (1).  

 

The Ghoulish mice exhibit resistance to LPS-induced necroptosis; necroptosis downstream of TNF has not been examined in the Ghoulish mice. The phenotype of the Ghoulish mice indicates loss of MLKL-associated function.

Primers PCR Primer
Ghoulish_pcr_F: TGTGGCTGACCTCCATGCTTAAATC
Ghoulish_pcr_R: CTGCCTCCAAGTTCATCTGGGAAG

Sequencing Primer
Ghoulish_seq_F: TGACCTCCATGCTTAAATCGAAAAG
Ghoulish_seq_R: GTTAGATTTACAGCCAAGCCTGTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 459 nucleotides is amplified (chromosome 8, - strand):


1   ctgcctccaa gttcatctgg gaagttagat ttacagccaa gcctgtcact ctggttttcc
61  ctataccaag agtcgctgat ggtgtctcaa gtacctgctt atatgcacgc tgaatgtata
121 gtatactgta cattctttaa gggaccatca aattccaaat gctaattttt cctttcaccc
181 acctagaata gtgaggttca ctttcaatga cgagatcaaa accatgaaga aattcgattc
241 tcccaacatc ttgcgtatat ttgggatttg cattgatcaa acaggtaagg gcactcctgg
301 gattggtcaa gctttgactg cttgtgtaga gtatactgtc cgagttttaa tgcattactt
361 tttctgagtt ttaaagaaaa gttaatttta gatctgcagg tgagagctta agaggttaga
421 gagctgtgct tttcgattta agcatggagg tcagccaca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsYing Wang and Bruce Beutler