Phenotypic Mutation 'Flogiston' (pdf version)
AlleleFlogiston
Mutation Type missense
Chromosome11
Coordinate59,449,274 bp (GRCm39)
Base Change A ⇒ T (forward strand)
Gene Nlrp3
Gene Name NLR family, pyrin domain containing 3
Synonym(s) Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
Chromosomal Location 59,432,395-59,457,781 bp (+) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_145827; MGI:2653833

MappedYes 
Amino Acid Change Histidine changed to Leucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000078440] [ENSMUSP00000098707]
AlphaFold Q8R4B8
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: H852L

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
(Using ENSMUST00000079476)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: H852L

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
(Using ENSMUST00000101148)
Meta Mutation Damage Score 0.1387 question?
Is this an essential gene? Probably nonessential (E-score: 0.076) question?
Phenotypic Category Unknown
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(25) : Chemically induced (ENU)(11) Chemically induced (other)(1) Targeted(13)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59456769 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59455942 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59442713 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59440204 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59440361 missense probably benign
IGL02334:Nlrp3 APN 11 59455909 missense probably benign
IGL02417:Nlrp3 APN 11 59456849 unclassified probably benign
IGL02578:Nlrp3 APN 11 59439227 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59456802 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59446608 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59440372 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59439842 missense probably damaging 1.00
nd1 UTSW 11 59456800 missense probably benign 0.45
Nd14 UTSW 11 59446701 missense possibly damaging 0.89
Nd3 UTSW 11 59456800 missense probably benign 0.45
nd5 UTSW 11 59456705 missense probably benign 0.01
nd6 UTSW 11 59440180 missense probably damaging 1.00
nd7 UTSW 11 59446701 missense possibly damaging 0.89
Nd9 UTSW 11 59440180 missense probably damaging 1.00
Park2 UTSW 11 59455954 nonsense probably null
Park3 UTSW 11 59456676 missense probably benign 0.02
Park4 UTSW 11 59440357 missense probably benign 0.19
Park5 UTSW 11 59439302 missense probably damaging 0.99
Park6 UTSW 11 59439862 missense probably damaging 1.00
Park7 UTSW 11 59438836 nonsense probably null
Park8 UTSW 11 59457025 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59449274 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59449274 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59455954 nonsense probably null
R0362:Nlrp3 UTSW 11 59439623 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59446750 splice site probably benign
R0649:Nlrp3 UTSW 11 59439368 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59439082 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59456676 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59446594 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59440357 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59439302 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59433949 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59434177 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59449228 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59439742 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59439862 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59439962 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59440487 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59438836 nonsense probably null
R4540:Nlrp3 UTSW 11 59442725 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59440048 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59439127 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59440064 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59439554 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59457025 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59439554 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59455910 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59439889 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59446574 nonsense probably null
R5869:Nlrp3 UTSW 11 59438960 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59437678 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59437617 missense probably benign
R5979:Nlrp3 UTSW 11 59439797 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59439392 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59456018 missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59439272 missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59438912 missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59455892 missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59433829 splice site probably null
R7916:Nlrp3 UTSW 11 59442689 missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59439614 missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59440229 missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59442616 missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59440097 missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59440216 missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59455870 missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59439584 missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59434141 missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59440148 missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59449378 frame shift probably null
RF040:Nlrp3 UTSW 11 59449378 frame shift probably null
Z1088:Nlrp3 UTSW 11 59442686 missense possibly damaging 0.67
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:30 PM by Anne Murray
Record Created 2019-01-22 1:35 PM by Bruce Beutler
Record Posted 2019-01-30
Phenotypic Description
Figure 1. Flogiston mice exhibited diminished IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Flogiston phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0008, some of which showed decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the reduced IL-1β secretion after nigericin treatment using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 100 mutations (X-axis) identified in the G1 male of pedigree R0008. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 100 mutations. The impaired NLRP3 inflammasome response was linked by continuous variable mapping to a mutation in Nlrp3: an A to T transversion at base pair 59,558,448 (v38) on chromosome 11, or base pair 16,880 in the GenBank genomic region NC_000077. Linkage was found with an unknown (additive/dominant) model of inheritance (P = 0.000326), wherein eight heterozygous mice departed phenotypically from eight homozygous reference mice (Figure 2); no homozygous variant mice were alive/available at time of screening.  

The mutation corresponds to residue 2,781 in the mRNA sequence NM_145827 within exon 7 of 10 total exons.

 

2765 GTTCTGAGCTCCAACCATTCTCTGACCAGACTG

847  -V--L--S--S--N--H--S--L--T--R--L-

The mutated nucleotide is indicated in red.  The mutation results in a histidine to leucine substitution at position 852 (H852L) in the NLRP3 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.002).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT-associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The Flogiston mutation results in a histidine to leucine substitution at position 852. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The Nlrp3 gene encodes a 1,033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family [Figure 3; (1)]. NLRP3 has a pyrin domain (PYD) at the N-terminus (amino acids 1-91). NLRP3 has a C-terminal leucine-rich repeat (LRR) domain (amino acids 739-988), a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD) that together comprise a nucleotide-binding domain (NBD; amino acids 216-532), and an N-terminal effector domain. The N-terminus of NLRP3 contains a pyrin domain (PYD; amino acids 1-91). 

The Flogiston mutation results in a histidine to leucine substitution at position 852 (H852L); His852 is within an undefined region between the fourth and fifth LRR.

Please see the record for Nd1 for more information about Nlrp3.

Putative Mechanism

NLRP3 is able to oligomerize through its NBD domain and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. A large variety of agents have been shown to activate the NLRP3 inflammasome, and NLRP3 plays an important role in the innate immune response. Mutations within the NBD have been shown to reduce ATP binding, as well as NLRP3 protein function including caspase-1 activation, IL-1β production, cell death, macromolecular complex formation, self-association, and association with apoptosis-associated speck-like protein (ASC). The phenotype of the Flogiston mice suggests that the mutated protein, if expressed, is inactive or has reduced activity.  

Primers PCR Primer
Flogiston_pcr_F: TGTTACTCCTTCAGACGGGGAAGAG
Flogiston_pcr_R: ATGCTGATGCTACGGTTCCCAC

Sequencing Primer
Flogiston_seq_F: AACTGTGTGGAGCTAAGGTGC
Flogiston_seq_R: TCTCCAGCAGATGAACATTCTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 437 nucleotides is amplified (chromosome 11, + strand):


1   tgttactcct tcagacgggg aagaggataa gaactgtgtg gagctaaggt gcaggttgta
61  gctgaggagg gcagtagcag gtacaggtct cctagcccac ggtgcagagt gcatgagaga
121 tggcactgac cttgttccct ctgcatggaa ggttggtgag ctgctgtctc acatccgcgt
181 gttgtcagga tctcgcattg gttctgagct ccaaccattc tctgaccaga ctgtacattg
241 gagaaaatgc cttgggagac tcaggagtcc aagttttgtg tgaaaagatg aaggacccac
301 agtgtaactt gcagaagctg gggtaagtaa gtcaaattct tctcagagat cgcttatttg
361 ggaagcacgc atgggtgggg cccctctaga gaatgttcat ctgctggaga tgaaggtggg
421 aaccgtagca tcagcat


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsHexin Shi, Ying Wang, and Bruce Beutler