Phenotypic Mutation 'Maennel'

• Allele: Maennel
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 65,232,824 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Pappa
• Gene Name: pregnancy-associated plasma protein A
• Synonym(s): PAPP-A, PAG1, 8430414N03Rik, IGFBP-4ase
• Chromosomal Location: 65,042,411-65,275,746 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Asparagine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000081545]
• AlphaFold: Q8R4K8
• SMART Domains: Protein: ENSMUSP00000081545; Gene: ENSMUSG00000028370; AA Change: N1321S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	24	66	N/A	INTRINSIC
low complexity region	69	87	N/A	INTRINSIC
LamGL	114	263	1.55e-54	SMART
NL	396	438	4.15e-8	SMART
NL	441	471	6.73e-1	SMART
Pfam:Peptidase_M43	500	657	2.5e-10	PFAM
Blast:FN3	669	929	1e-165	BLAST
CCP	1212	1277	1.39e-9	SMART
CCP	1282	1339	1.08e-6	SMART
CCP	1343	1407	1.64e-6	SMART
CCP	1412	1468	8.06e-6	SMART
NL	1544	1581	3.24e-10	SMART
low complexity region	1584	1591	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
  (Using ENSMUST00000084501)
• Meta Mutation Damage Score: 0.0672
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Diantha La Vine
• Record Created: 2019-01-22 2:12 PM by Bruce Beutler
• Record Posted: 2019-02-27
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Zhao Zhang and Bruce Beutler

Accession Number

NCBI RefSeq: NM_021362; MGI:97479

Alleles Listed at MGI

All Mutations and Alleles(4) : Targeted (4)

Phenotypic Description

Figure 1. Maennel mice exhibited reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Maennel phenotype was identified among G3 mice of the pedigree R4043, the males of which showed reduced body weights compared to sex-matched wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R4043. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The body weight phenotype was linked to a mutation in Pappa:  an A to G transition at base pair 65,314,587 (v38) on chromosome 4, or base pair 190,414 in the GenBank genomic region NC_000070. Linkage was found with a dominant model of inheritance, wherein one variant homozygote and four heterozygous mice departed phenotypically from five homozygous reference mice with a P value of 0.000371 (Figure 2).  

The mutation corresponds to residue 4,330 in the mRNA sequence NM_021362 within exon 16 of 22 total exons.

4314 CAGCTGAAAGGCAACAACAGCTTTCTGACCTGT 1316 -Q--L--K--G--N--N--S--F--L--T--C-

The mutated nucleotide is indicated in red. The mutation results in an asparagine to serine substitution at position 1,321 (N1321S) in the PAPP-A protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.055).

Protein Prediction

Figure 3. Domain organization of PAPP-A. The Maennel mutation results in an asparagine to serine substitution at position 1,321. This image is interactive. Other mutations found in PAPP-A are noted in red. Click on each allele for more information. Abbreviations: SP, signal peptide; LNR: Lin12/Notch repeats; CCP, complement control protein

Pappa encodes pregnancy-associated plasma protein A (PAPP-A; alternatively, IGFBP4 protease or differentially expressed in placenta 1 [DIPLA1]), a member of the pappalysin subfamily of the metzincin protease family along with PAPP-A2 (see the record for Lilliputian) and ulilysin. PAPP-A is initially translated as a 1,624 proprotein; cleavage of the signal peptide and the propeptide (amino acids 23-80) generates the mature 1,544 amino acid peptide (1). PAPP-A has several domains, including a signaling peptide (amino acids 1-22), a laminin G-like domain, three Lin12/Notch repeats (LNRs), a metalloprotease region (amino acids 272-583), and five complement control protein (CCP) domains (alternatively, short consensus repeat [SCR] or Sushi domains; amino acids 1210-1279, 1280-1341, 1342-1409, 1410-1470, and 1473-1553) (Figure 3) (2).

The Maennel mutation results in an asparagine to serine substitution at position 1,321 (N1321S); Asn1321 is within the second CCP domain.

Please see the record caer for more information about Pappa.

Putative Mechanism

PAPP-A is a secreted metalloproteinase that cleaves insulin-like growth factor binding protein 2 (IGFBP2), IGFBP4, and IGFBP5. The IGFBPs regulate the IGF-I signaling pathways by binding IGF-I. IGFBP5 also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor to enter the cytoplasm and subsequently interact with, and regulate, other proteins. IGFBPs are carrier proteins that regulate the bioavailability of insulin-like growth factors (IGFs) by prolonging their-half-life and circulation turnover. IGFs are essential for the regulation of growth and development by influencing the proliferation, differentiation, and apoptosis of osteoblasts (3;4). IGFs bind to two types of receptors, IGF-IR and IGF-IIR, subsequently activating downstream tyrosine kinase pathways. In IGF-I-associated signaling, both the IRS-1/phosphoinositide 3-kinase/serine–threonine kinase pathway and the Ras/mitogen-activated protein kinase/extracellular signal-regulated kinase pathway are activated, which subsequently promote cell proliferation, tissue differentiation, and protection from apoptosis.

Pappa-deficient (Pappa^-/-) mice showed reduced body sizes and weights (60 to 70% of wild-type mice) as well as delayed bone ossification (5). The phenotype of the Maennel mice mimics that of the Pappa^-/- mice, indicating loss of PAPP-A function. PAPP-A functions as a growth-promoting enzyme through its role in cleaving IGFBPs (and subsequent release of bioactive IGF). IGFBP4 cleavage is required to activate most, if not all, IGF2-mediated growth-promoting activity.

Primers

PCR Primer
Maennel_pcr_F: CTTTGTAAGAACTGCCCAGCAC
Maennel_pcr_R: AGCGGCACTTACTTCTTGGAC

Sequencing Primer
Maennel_seq_F: CAGCACACTCCAGAGATACTG
Maennel_seq_R: TTGGACTTCCGAGATGAGCCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 4, + strand):

1   ctttgtaaga actgcccagc acactccaga gatactgagt tcttagagga aggcattgga
61  attctaacca gggatcccaa gggaccacat attggttaaa atccaggcag ctcatgtgtt
121 atcttagatg tttcggggct cattcttcta ctaaacctgt cttcctgtgt cttccaggca
181 acaacagctt tctgacctgt atggaagatg gactgtggtc cttcccagag gccttgtgtg
241 agctcatgtg cctcgcccca cccccagttc ccaatgcgga cctacagaca gcccggtgtc
301 gagagaacaa gcacaaggtg ggctccttct gcaagtacaa gtgtaaacct ggataccacg
361 tgcctggctc atctcggaag tccaagaagt aagtgccgct 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Haaning, J., Oxvig, C., Overgaard, M. T., Ebbesen, P., Kristensen, T., and Sottrup-Jensen, L. (1996) Complete cDNA Sequence of the Preproform of Human Pregnancy-Associated Plasma Protein-A. Evidence for Expression in the Brain and Induction by cAMP. Eur J Biochem. 237, 159-163.

  2. Kristensen, T., Oxvig, C., Sand, O., Moller, N. P., and Sottrup-Jensen, L. (1994) Amino Acid Sequence of Human Pregnancy-Associated Plasma Protein-A Derived from Cloned cDNA. Biochemistry. 33, 1592-1598.

  3. Govoni, K. E., Baylink, D. J., and Mohan, S. (2005) The Multi-Functional Role of Insulin-Like Growth Factor Binding Proteins in Bone. Pediatr Nephrol. 20, 261-268.

  4. Mohan, S., Richman, C., Guo, R., Amaar, Y., Donahue, L. R., Wergedal, J., and Baylink, D. J. (2003) Insulin-Like Growth Factor Regulates Peak Bone Mineral Density in Mice by both Growth Hormone-Dependent and -Independent Mechanisms. Endocrinology. 144, 929-936.

  5. Conover, C. A., Bale, L. K., Overgaard, M. T., Johnstone, E. W., Laursen, U. H., Fuchtbauer, E. M., Oxvig, C., and van Deursen, J. (2004) Metalloproteinase Pregnancy-Associated Plasma Protein A is a Critical Growth Regulatory Factor during Fetal Development. Development. 131, 1187-1194.