Phenotypic Mutation 'Gulliver' (pdf version)
AlleleGulliver
Mutation Type missense
Chromosome1
Coordinate158,857,136 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Pappa2
Gene Name pappalysin 2
Synonym(s) pregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Chromosomal Location 158,711,727-158,980,490 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001085376; MGI:3051647

Mapped Yes 
Amino Acid Change Threonine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000124022 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: T811I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect probably null

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000159861)
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 23457539
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.49
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) :  Chemically induced (ENU)(3) Chemically induced (other)(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
R7020:Pappa2 UTSW 1 158848009 missense probably damaging 0.98
R7051:Pappa2 UTSW 1 158957183 missense unknown
R7082:Pappa2 UTSW 1 158763119 missense possibly damaging 0.65
R7111:Pappa2 UTSW 1 158956526 missense probably benign 0.38
R7213:Pappa2 UTSW 1 158936886 missense possibly damaging 0.93
R7575:Pappa2 UTSW 1 158814530 missense probably damaging 1.00
R7587:Pappa2 UTSW 1 158851131 missense probably damaging 1.00
R7826:Pappa2 UTSW 1 158936440 nonsense probably null
R8007:Pappa2 UTSW 1 158782304 missense probably damaging 0.99
R8050:Pappa2 UTSW 1 158848400 missense probably damaging 1.00
R8063:Pappa2 UTSW 1 158936556 missense possibly damaging 0.79
R8068:Pappa2 UTSW 1 158935985 missense possibly damaging 0.87
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Z1176:Pappa2 UTSW 1 158814814 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158814816 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158956933 missense probably benign
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:30 PM by Anne Murray
Record Created 2019-01-22 2:13 PM by Bruce Beutler
Record Posted 2019-01-30
Phenotypic Description
Figure 1. Gulliver mice exhibit reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Gulliver mice exhibit decreased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Gulliver phenotype was identified among G3 mice of the pedigree R4952, some of which showed reduced body weights compared to wild-type littermates (Figure 1). Some mice also showed reduced frequencies of CD44+ CD8 T cells in the peripheral blood (Figure 2).

Nature of Mutation
Figure 3. Linkage mapping of the reduced CD8+ T cell phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R4952. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. Both of the above phenotypes were linked to mutations in two genes on chromosome 1: Pappa2 and Gm4846. The mutation in Pappa2 was presumed causative as the body weight phenotype in gulliver mimics that of other alleles of Pappa2. The Pappa2 mutation is a C to T transition at base pair 158,857,136 (v38) on chromosome 1, or base pair 123,392 in the GenBank genomic region NC_000067. The strongest association was found with an additive model of inheritance, wherein one variant homozygote and 16 heterozygous mice departed phenotypically from seven homozygous reference mice with a P value of 4.259 x 10-6 (Figure 3).

 

The mutation corresponds to residue 2,432 in the mRNA sequence NM_001085376 within exon 4 of 22 total exons.

 

2416 AACTACATGAGCTACACAGATGATGAGTGCACT

806  -N--Y--M--S--Y--T--D--D--E--C--T-

 

The mutated nucleotide is indicated in red. The mutation results in a threonine to isoleucine substitution at position 811 (T811I) in the PAPP-A2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 4. Domain figure of PAPP-A2. The Gulliver mutation (Y265F) is shown. Abbreviations: SP, signal peptide; Laminin, laminin G-like domain; LNR, Lin12/Notch repeats; FN3, fibronectin 3-like domain; CCP/SCR, complement control protein/short consensus repeat. This image is interactive. Other mutations found in PAPP-A2 are npted in red. Click on each mutation for more information.

Pappa2 encodes pregnancy-associated plasma protein A2 (PAPP-A2; alternatively, PAPP-E), a member of the pappalysin group of the metzincin protease family along with PAPP-A and ulilysin. PAPP-A2 is a 1,789-amino acid protein that has several domains: a signaling peptide (amino acids 1-18), a laminin G-like domain (amino acids 271-440), a peptidase/proteolytic domain (amino acids 669-832), a fibronectin 3-like domain (FN3; amino acids 844-1103), four complement control protein (CCP) domains (alternatively, short consensus repeat (SCR); amino acids 1394-1457, 1462-1519, 1523-1588, and 1593-1644), and two Lin12/Notch repeats (LNRs; amino acids 572-614 and 1720-1757) (Figure 4) (1).

 

The mutation results in a threonine to isoleucine substitution at position 811 (T811I); Thr811 is within the peptidase domain.

 

Please see the record Lilliputian for more information about Pappa2.

Putative Mechanism

PAPP-A2 is a protease that acts on insulin-like growth factor binding protein 5 (IGFBP5), a factor involved in bone metabolism (2;3) and IGFBP3 (4). IGFBP5 regulates the IGF-I signaling pathways by binding IGF-I. IGFBP5 also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor to enter the cytoplasm and subsequently interact with, and regulate, other proteins. Studies have shown that PAPP-A2 has roles in human pregnancy (5), reproductive traits in cattle (6), and postnatal growth in mice (7;8). Pappa2-deficient (Pappa2-/-) mice are viable and smaller than wild-type mice (8). At 3-18 weeks of age, the male Pappa2-/- mice had approximately 10% lower body weights than that in age-matched wild-type mice (8). Weight reduction was more pronounced in female mice compared to that in age-matched male mice (8). In the female mice, all organs except ovaries were larger than that in wild-type mice. The Pappa2-/- mice have shorter femur length than that in wild-type mice, but do not exhibit changes in bone mineral density. Pappa2 deletion does not affect placental or embryonic mass at embryonic day 12.5 (9). At birth, the Pappa2-/- mice exhibited a trend towards lower birth mass (9). At 3, 6, and 10 weeks of age, the Pappa2-/- mice exhibited reduced body mass and tail lengths compared to wild-type mice (9). The shape of the pelvic girdle significantly differed between that in the Pappa2-/- and wild-type mice; the Pappa2-/- mice had a more feminine shape and was disproportionately small (9). Matings between Pappa2-/- mice exhibited a delay to first litter, increased number of days between litter, and a reduced number of pups per litter compared to matings between wild-type mice (8). Although Pappa2 deletion results in diminished levels of circulating IGF-I, IGFBP-3, and IGFBP-5, there were no glucose metabolism phenotypes observed (10). In addition, loss of Pappa2 expression did not result in weight gain or adiposity on a high-fat diet (10). Loss of Pappa2 expression in mouse does not effect female fertility, but has subtle effects on male fertility (11).

 

The body weight phenotype of the Gulliver mice indicates loss of PAPP-A2-associated function.

Primers PCR Primer
Gulliver_pcr_F: TTTCACTTTCAAGCTCTCATGGAAG
Gulliver_pcr_R: AGAATCCTGTGATGATCCCTGTAG

Sequencing Primer
Gulliver_seq_F: TTCAAGCTCTCATGGAAGAGAATCC
Gulliver_seq_R: CCTGTGATGATCCCTGTAGAGAGAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 1, - strand):


1   agaatcctgt gatgatccct gtagagagac agtgccatcc atggagacag gagacctgtg
61  tgctgacact gctcccacac ccaagagcaa gctgtgtcgg gacccagagc cagctaatga
121 cacctgtggc ttcaccctct tcccaggggc tccgttcaat aactacatga gctacacagg
181 tatcaccaca agcccaatgt ttttgtttca ttaagatcat ttagtgtctt tgggaattgg
241 taggctgtag ctaatggagc caggaagatt catgtcacat gaatactttg tgttgggtat
301 tcctgtattt tccgtgtgtt tgtttgaagt ttgacaaaat attgagatag taaatggtct
361 tgttgattgg attctcttcc atgagagctt gaaagtgaaa 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang, Xue Zhong, Jin Huk Choi, and Bruce Beutler