Phenotypic Mutation 'Astro_boy' (pdf version)
AlleleAstro_boy
Mutation Type missense
Chromosome13
Coordinate101,701,732 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Pik3r1
Gene Name phosphoinositide-3-kinase regulatory subunit 1
Synonym(s) p55alpha, p85alpha, PI3K, p50alpha
Chromosomal Location 101,680,563-101,768,217 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit perinatal lethality associated with hepatic necrosis, chylous ascites, enlarged muscle fibers, calcification of cardiac tissue, and hypoglycemia. Mutants lacking only the major isoform are immunodeficient. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001024955 (variant 1), NM_001077495 (variant 2); MGI:97583

Mapped Yes 
Amino Acid Change Leucine changed to Histidine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000056774]
SMART Domains Protein: ENSMUSP00000056774
Gene: ENSMUSG00000041417
AA Change: L272H

DomainStartEndE-ValueType
SH3 6 78 2.81e-11 SMART
low complexity region 79 99 N/A INTRINSIC
RhoGAP 126 298 1.94e-37 SMART
low complexity region 303 314 N/A INTRINSIC
SH2 331 414 9.96e-28 SMART
Pfam:PI3K_P85_iSH2 431 599 7.8e-67 PFAM
SH2 622 704 7.33e-26 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000055518)
Meta Mutation Damage Score 0.6277 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1 cells - decreased
FACS B1b cells in B1 cells - increased
FACS B220 MFI - decreased
FACS CD11b+ DCs (gated in CD11c+ cells) - increased
FACS CD4+ T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM MFI - increased
FACS IgM+ B cells - decreased
IgE response to a Cysteine Protease (Papain) - increased
resistance to B10-F16 melanoma - decreased
Candidate Explorer Status CE: not good candidate; Verification probability: 0.136; ML prob: 0.186; human score: -1
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(32) : Chemically induced (ENU)(2) Endonuclease-mediated(1) Gene trapped(20) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pik3r1 APN 13 101690536 start codon destroyed probably benign
IGL00484:Pik3r1 APN 13 101701747 missense probably benign 0.08
IGL00911:Pik3r1 APN 13 101757661 utr 5 prime probably benign
IGL01620:Pik3r1 APN 13 101686220 missense probably damaging 1.00
IGL01872:Pik3r1 APN 13 101689117 missense probably benign 0.01
IGL02544:Pik3r1 APN 13 101687276 missense probably damaging 1.00
IGL02959:Pik3r1 APN 13 101757529 missense probably benign 0.02
anubis UTSW 13 101702776 nonsense probably null
Pennywhistle UTSW 13 101689406 missense probably damaging 0.96
Rocket UTSW 13 101689444 missense probably damaging 1.00
R0635:Pik3r1 UTSW 13 101757418 missense probably benign
R0751:Pik3r1 UTSW 13 101686358 splice site probably null
R0787:Pik3r1 UTSW 13 101690523 missense probably benign 0.30
R0845:Pik3r1 UTSW 13 101686264 missense probably benign 0.45
R0891:Pik3r1 UTSW 13 101701466 missense probably benign
R1066:Pik3r1 UTSW 13 101688663 missense probably damaging 1.00
R1184:Pik3r1 UTSW 13 101686358 splice site probably null
R1735:Pik3r1 UTSW 13 101686374 missense probably damaging 1.00
R2474:Pik3r1 UTSW 13 101702776 nonsense probably null
R3015:Pik3r1 UTSW 13 101687263 missense probably damaging 1.00
R3419:Pik3r1 UTSW 13 101692215 missense probably benign 0.17
R3876:Pik3r1 UTSW 13 101684957 missense probably benign 0.01
R3964:Pik3r1 UTSW 13 101688685 missense possibly damaging 0.75
R4175:Pik3r1 UTSW 13 101701732 missense probably damaging 1.00
R4175:Pik3r1 UTSW 13 101701733 missense probably benign 0.25
R4422:Pik3r1 UTSW 13 101694384 missense probably benign
R4890:Pik3r1 UTSW 13 101757610 missense probably damaging 1.00
R5038:Pik3r1 UTSW 13 101689444 missense probably damaging 1.00
R5117:Pik3r1 UTSW 13 101692236 missense probably benign
R6066:Pik3r1 UTSW 13 101686320 missense possibly damaging 0.72
R6254:Pik3r1 UTSW 13 101689406 missense possibly damaging 0.89
R7421:Pik3r1 UTSW 13 101689136 missense probably damaging 1.00
R7507:Pik3r1 UTSW 13 101708982 missense probably benign 0.00
R7538:Pik3r1 UTSW 13 101689406 missense probably damaging 0.96
R7605:Pik3r1 UTSW 13 101702838 missense probably benign
R7739:Pik3r1 UTSW 13 101709697 missense probably benign 0.01
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2020-07-29 6:45 PM by External Program
Record Created 2019-01-22 2:21 PM by Bruce Beutler
Record Posted 2019-02-14
Phenotypic Description

Figure 1. Astro_boy mice exhibit increased frequencies of peripheral B1b cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The astro_boy phenotype was identified among G3 mice of the pedigree R4175, some of which showed increased frequencies of B1b cells in B1 cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased B1b cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 43 mutations (X-axis) identified in the G1 male of pedigree R4175. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 43 mutations. The B1b phenotype was linked by continuous variable mapping to two mutations in Pik3r1 (10170132A>T [p.L272H] and 101701733G>A [p.L272F]). The mutation at base pair 101,701,732 was presumed causative as it is predicted to cause damage to the protein (PolyPhen score = 1.000), while the 101701733G>A mutation is predicted to benign (PolyPhen score = 0.248). The causative mutation in Pik3r1 is a T to A transversion at base pair 101,701,732 (v38) on chromosome 13, or base pair 66,486 in the GenBank genomic region NC_000079 encoding Pik3r1. Linkage was found with an additive model of inheritance, wherein three homozygous variants and 19 heterozygous mice departed phenotypically from 13 homozygous reference mice with a P value of 0.000305 (Figure 2). 

 

The mutation corresponds to residue 1,436 in the mRNA sequence NM_001077495 within exon 6 of 16 total exons.

 

1420 ATTTTCAGCCCCGTGCTTTTCAGATTTCCAGCC

267  -I--F--S--P--V--L--F--R--F--P--A-  (p85α)


 

The mutated nucleotide is indicated in red. The mutation results in a leucine to histidine substitution at residue 272 (L272H) in the p85α protein (PolyPhen-2 score = 1.000); the mutation is not predicted to affect the p55α and p50α isoforms.

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain structures of p85 isoforms. Pik3r1 encodes p85α, p55α and p50α. Common to all isoforms are the presence of two C-terminal SH2 domains flanking a p110-binding domain (iSH2). The smaller isoforms differ at their N-terminus and contain a unique 35-amino-acid (p55α) or five-amino-acid (p50α) sequence. Unique to the larger isoforms are the N-terminal SH3 domain, RhoGAP domain and two proline-rich regions. The astro_boy mutation results in a leucine to histidine substitution at residue 272 (L272H) in the p85α protein. The mutation is not predicted to alter p55α and p50α. This image is interactive. Additional Pik3r1 mutations are noted in red. Click on each allele for more information.

Pik3r1 encodes p85α, a regulatory subunit of class IA phosphatidylinositol 3-kinases (PI3Ks). To form a functional class I PI3K, a p110 catalytic subunit forms a heterodimer with a p85 regulatory subunit (1;2). In activated cells, the p85 subunit recruits the p110 subunit to the plasma membrane and activates it (3-5). Conversely, the p85 subunit also inhibits the enzymatic activity of the p110 subunit in quiescent cells (6). The p85 subunits also mediate the interactions of the PI3Ks with the cytoplasmic domains of receptors as well as with adaptor proteins (7).

 

p85α, p55α, and p50α are splice variants of Pik3r1 (3;8;9). The p55α and p50α isoforms have two SH2 (Src homology 2) domains [nSH2 (N-terminal SH2 domain) and cSH2 (C-terminal SH2 domain)] and a p110-binding domain [iSH2 (inter SH2 domain)] (Figure 3). The p85α isoform has the nSH2, cSH2, and iSH2 domains, but also has a SH3 domain at the N-terminus (amino acids 6-78) and a RhoGAP domain (amino acids 126-298). Between the SH3 and RhoGAP domain and between the RhoGAP and nSH2 domain are proline-rich regions.

 

The astro_boy mutation results in a leucine to histidine substitution at residue 272 (L272H) in the p85α protein. Amino acid 272 in p85α is within the RhoGAP domain.

 

For more information about Pik3r1, please see the record for anubis.

Putative Mechanism

PI3Ks are highly conserved lipid signaling kinases. After cell stimulation by growth factors, hormones, cytokines, or antigens, the PI3Ks are recruited to the inner face of the plasma membrane where they phosphorylate phosphatidylinositol (PtdIns), PtdIns 4-phosphate, and/or PtdIns-4,5-bisphosphate (PtdIns(4,5)P2; PIP2) at the D3 position of the inositol ring, generating their respective D3’ phosphorylated derivatives [e.g., PIP2 phosphorylation generates the second messenger phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3; PIP3); (2;10); reviewed in (7;11)].  For more information on the PI3K signaling pathway, please see the record for sothe and stinger.

 

PIK3R1 mutations are linked to immunodeficiency-36 (IMD36; OMIM: #616005(12)), agammalobulinemia-7 (AGM7; OMIM: #615214(13)), and SHORT (Short stature, Hyperextensible joints, Ocular depression, Rieger anomaly, and Teeth delay) syndrome (OMIM: #269880(14;15)). Patients with IMD36 had decreased numbers of naïve CD4+ and CD8+ T cells; one patient had decreased numbers of memory B cells (12). A patient with AGM7 exhibited defects in early B cell development (13).

 

Pik3r1-/- chimeric mice (using a Rag2-deficient blastocyst complementation system) had reduced numbers of peripheral blood mature B cells and reduced serum levels of IgM, IgG1, IgG2a, IgG3, and IgA (16). The remaining B cells exhibited reduced proliferative responses after exposure to anti-IgM, anti-CD40, and lipopolysaccharide; T cell development and proliferative responses were normal. The anubis mice exhibited defects in T cell development similar to patients with IMD36 (12), but in contrast to the Pik3r1-/- chimeric mice (16).

 

The immune phenotypes in the astro_boy mice indicates that loss of p85α-associated function.

Primers PCR Primer
Astro_boy_pcr_F: GCTGCAACAAAGAGCATTTTG
Astro_boy_pcr_R: TTTTGAACCTGCAGAACTACAGAG

Sequencing Primer
Astro_boy_seq_F: CAAAGAGCATTTTGTGAGAACCATC
Astro_boy_seq_R: GAGCCCTGAAGACTGCATC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 13, - strand):


1   ttttgaacct gcagaactac agagccctga agactgcatc cagctgttga agaagctcat
61  tagattgcct aatatacctc atcagtgttg gcttacgctt cagtatttgc tcaagcattt
121 tttcaagctc tctcaagcct ccagcaaaaa ccttttgaat gcaagagtcc tctctgagat
181 tttcagcccc gtgcttttca gatttccagc cgccaggtaa gtgaaggatg aaaagaaggt
241 tcggacggta tgggtgagag ctgatgagtg gccctaaatt gatgcctcac agatgcacgt
301 tttctgggga cttacttcac acacatcaat aggatgtaga tgaatgaaaa gagaattact
361 tttagaaatg atggttctca caaaatgctc tttgttgcag c


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler