Allele | rsq2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | X | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 166,090,941 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Tlr7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | toll-like receptor 7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 166,087,925-166,113,554 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung, placenta, and spleen, and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Jul 2008] PHENOTYPE: The innate immune response to viral infection is affected in homozygous null mice. Mice homozygous or hemizygous for a point mutation produce little or no tumor necrosis factor (TNF) alpha in response to stimulation by a single stranded RNA analog. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Asparagine changed to Tyrosine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P58681 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000061853 Gene: ENSMUSG00000044583 AA Change: N182Y
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000107787 Gene: ENSMUSG00000044583 AA Change: N182Y
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000107789 Gene: ENSMUSG00000044583 AA Change: N182Y
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.168) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | X-linked Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(5) : Targeted, knock-out(2) Targeted, other(1) Chemically induced(2) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | X-linked Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 030753-UCD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2008-10-20 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The rsq2 mutant was discovered in a screen of N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from rsq2 mice fail to produce tumor necrosis factor (TNF)-α in response to R-848, a single stranded RNA mimetic that activates TLR7 (Figure 1). However, TNF-α production is normal following stimulation with MALP-2 (macrophage-activating lipopeptide-2, TLR2/6 ligand), CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand), Pam3CSK4 (a triacyl lipopeptide, TLR2/1 ligand), poly I:C (TLR3 ligand) and lipopolysaccharide (LPS, TLR4 ligand).
A second mutant with the same mutation, designated rsq3, was isolated independently as a descendant of a different ENU-mutagenized G0 male. The current breeding strategy crosses G1 females from an original G0 to multiple other G0 mice in order to more quickly recover mutations (please see the FAQ page for a description of the breeding strategy). Thus, It is likely that both the rsq2 and rsq3 mutants have a common G0 ancestor.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
721 CTCTACCTGGGTCAAAACTGTTATTATCGAAAT
177 -L--Y--L--G--Q--N--C--Y--Y--R--N-
The mutated nucleotide is indicated in red lettering, and results in a conversion of asparagine to tyrosine at residue 182 of the TLR7 protein (Figure 2).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism |
The rsq2 mutation alters the tenth residue of the fifth TLR7 LRR. The LRRs of the TLR proteins mediate ligand recognition and binding. The first ten residues of all LRR subtypes contain a conserved leucine-rich motif that typically ends in an asparagine, followed by a second leucine-rich motif that varies in length, sequence, and structure. The fifth LRR of TLR7, along with LRRs 2 and 8, contain long insertions following the consensus asparagine. These insertions, along with the insertion in LRR11, are positioned proximal to the β-strands formed by the first ten residues. It is thought that these four insertions create the ligand-binding site (1). Alteration of the asparagine residue in LRR5 of TLR7 is likely to affect the structure of the LRR and inhibit ligand-binding. Although the effects of this mutation on TLR7 structure and function have not been directly tested, TLR7 signaling is severely reduced, if not completely abolished, in rsq2 mice.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping |
Rsq2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The same PCR primers are used as for rsq1 genotyping.
Primers for PCR amplification
Rsq1(F): 5’- AGCACTCTTCGCAGCAACTAATATGTAA -3’
Rsq1(R): 5’- CCAACTCAACAAGGTTGGGAAGAAAATG -3’
PCR program
1) 94°C 2:00
2) 94°C 0:15
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 35X
6) 72°C 10:00
7) 4°C ∞
Primers for sequencing
Rsq2_seq(F): 5’- GTGGACTCTCTGACTTAAAAGCC -3’
Rsq2_seq(R): 5’- ATGCAAAAATTTGGCCTCCTC -3’
The following sequence of 1911 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Tlr7) is amplified:
21166 agcac tcttcgcagc
21181 aactaatatg taatgctgct tctgtatctt aaaaactgtt tggggcagca agagacatgg
21241 ctcagtgggt aagtatggtg atgtgaatgt gaatgacccc gtaggctcat gtttgaatac
21301 ttggttccca gtcagtggaa cttttggcaa ggattaggag gtgtggcttt gttgaaagag
21361 gtgtgccact agaggtaggc tgtgagattt caaaagtcca tgcccatccc agtctcattc
21421 cttctctgcc tacaatttgc agataacatg tgagctctca gcagctgctc cagtgtcatg
21481 cctacctgtc tgctaccatg tttcctgtca tgatatcata aactaaccct ctaaaactct
21541 aggcaagaac cagagcaaat gctttgtttt ctaaggtgtt gtggtcatag tggttcatca
21601 cagcaataga aacagtaatg agacagtaag tgtacttgtg gacaagactg atgacctgcg
21661 tttgatctgc aggatccaca aggtggaagg agataacaga ctctcacaag ttatcctctg
21721 accgccacaa tcacgtcatg gtatgtgcac actcactgac atatgcaaag catactcaca
21781 caagacaaat aaataaatgt gaaaaaattc ttgaagtttg ttagaaagct aagatggtac
21841 aagcaaaaca taaaaccatt atcaaagtct tcagtggtta ataagtacag tcacagggac
21901 ggaggtgctg tttacactat tacaaacaag acctgtgttg tttagtttta ataatgtacc
21961 aaaagagagg aaataaatgg aacttctcaa tcattccttg atatatttta taacaataat
22021 ttttttctct cttttattta caggtgtttt cgatgtggac acggaagaga caaattttga
22081 tctttttaaa tatgctctta gtttctagag tctttgggtt tcgatggttt cctaaaactc
22141 taccttgtga agttaaagta aatatcccag aggcccatgt gatcgtggac tgcacagaca
22201 agcatttgac agaaatccct gagggcattc ccactaacac caccaatctt acccttacca
22261 tcaaccacat accaagcatc tctccagatt ccttccgtag gctgaaccat ctggaagaaa
22321 tcgatttaag atgcaattgt gtacctgttc tactggggtc caaagccaat gtgtgtacca
22381 agaggctgca gattagacct ggaagcttta gtggactctc tgacttaaaa gccctttacc
22441 tggatggaaa ccaacttctg gagataccac aggatctgcc atccagctta catcttctga
22501 gccttgaggc taacaacatc ttctccatca cgaaggagaa tctaacagaa ctggtcaaca
22561 ttgaaacact ctacctgggt caaaactgtt attatcgaaa tccttgcaat gtttcctatt
22621 ctattgaaaa agatgctttc ctagttatga gaaatttgaa ggttctctca ctaaaagata
22681 acaatgtcac agctgtcccc accactttgc cacctaattt actagagctc tatctttata
22741 acaatatcat taagaaaatc caagaaaatg attttaataa cctcaatgag ttgcaagttc
22801 ttgacctaag tggaaattgc cctcgatgtt ataatgtccc atatccgtgt acaccgtgtg
22861 aaaataattc ccccttacag atccatgaca atgctttcaa ttcattgaca gaattaaaag
22921 ttttacgttt acacagtaat tctcttcagc atgtgccccc aacatggttt aaaaacatga
22981 gaaacctcca ggaactagac ctctcccaaa actacttggc cagagaaatt gaggaggcca
23041 aatttttgca ttttcttccc aaccttgttg agttgg
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Nora G. Smart | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Owen M. Siggs, Bruce Beutler |