Phenotypic Mutation 'Naphthalene'

• Allele: Naphthalene
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 124,698,752 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Ptpn6
• Gene Name: protein tyrosine phosphatase, non-receptor type 6
• Synonym(s): Hcph, SHP-1, hcp, Ptp1C
• Chromosomal Location: 124,697,670-124,715,672 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000004377] [ENSMUSP00000108103] [ENSMUSP00000129124] [ENSMUSP00000133991] [ENSMUSP00000133429]
• AlphaFold: P29351
• SMART Domains: Protein: ENSMUSP00000004377; Gene: ENSMUSG00000004266; AA Change: T521A

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
  (Using ENSMUST00000004377)
• SMART Domains: Protein: ENSMUSP00000108103; Gene: ENSMUSG00000004266; AA Change: T519A

Domain	Start	End	E-Value	Type
SH2	2	85	4.05e-28	SMART
SH2	108	200	1.45e-29	SMART
PTPc	243	517	7.51e-131	SMART
low complexity region	569	579	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
  (Using ENSMUST00000112484)
• SMART Domains: Protein: ENSMUSP00000129124; Gene: ENSMUSG00000004266; AA Change: T521A

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
  (Using ENSMUST00000171549)
• SMART Domains: Protein: ENSMUSP00000134274; Gene: ENSMUSG00000004266; AA Change: T18A

Domain	Start	End	E-Value	Type
SCOP:d1eeoa_	2	38	1e-3	SMART
PDB:3PS5|A	2	91	2e-41	PDB

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
  (Using ENSMUST00000173315)
• SMART Domains: Protein: ENSMUSP00000133991; Gene: ENSMUSG00000004266; AA Change: T480A

Domain	Start	End	E-Value	Type
Pfam:SH2	1	40	3.5e-6	PFAM
SH2	69	161	1.45e-29	SMART
PTPc	204	478	7.51e-131	SMART
low complexity region	530	540	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000174265)
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0854
• Is this an essential gene?: Possibly nonessential (E-score: 0.481)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-10-23 1:57 PM by Anne Murray
• Record Created: 2019-01-22 6:05 PM by Bruce Beutler
• Record Posted: 2019-02-01
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013545 (variant 1), NM_001077705 (variant 2); MGI:96055

Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(7) Endonuclease-mediated(1) Gene trapped(3) Spontaneous (4) Targeted(5)

Phenotypic Description

Figure 1. Naphthalene mice exhibit increased CD44 expression on peripheral blood T cells . Flow cytometric analysis of peripheral blood was utilized to determine CD44 mean fluorescence intensity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The naphthalene phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2047, some of which showed increased CD44 expression on peripheral blood T cells (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased CD44 expression on peripheral blood T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R2047. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. The CD44 expression phenotype was linked by continuous variable mapping to a mutation in Ptpn6: is an A to G transition at base pair 124,721,789 (v38) on chromosome 6, or base pair 16,921 in the GenBank genomic region NC_000072. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 13 homozygous reference mice and nine heterozygous mice with a P value of 0.000170  (Figure 2).  

The mutation corresponds to residue 1,756 in the mRNA sequence NM_013545 within exon 13 of 16 total exons.

1741 CAGTTCATCGAAACGACCAAGAAGAAACTGGAG 514  -Q--F--I--E--T--T--K--K--K--L--E-

The mutated nucleotide is indicated in red.  The mutation results in a threonine to alanine substitution at position 519 (T519A) in variant 1 of the SHP1 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.001).

Protein Prediction

Figure 2. Domain structure of SHP1. The position of the naphthalene mutation is indicated. Other mutations found in SHP1 are noted in red. Click on the mutations for more specific information.

Ptpn6 encodes SHP1, a Src-homology 2 (SH2) domain-containing cytoplasmic protein tyrosine phosphatase. SHP1 has 4 isoforms. Three isoforms of SHP1 contain variations in their N-termini; the fourth isoform is a longer form with an extended C-terminus. SHP1 contains two tandem N-terminal SH2 domains (residues 1-108 and 116-208), a central catalytic domain (residues 270-532), and a C-terminal tail [Figure 3; (1), discussed in (2)]. The C-terminal tail contains multiple sites for tyrosine and serine phosphorylation.

The naphthalene mutation results in a threonine to alanine substitution at position 519 (T519A) within the phosphatase domain.

For more information on Ptpn6, please see the record for spin.

Putative Mechanism

The phenotype of the naphthalene mice suggests decreased SHP1 function. The phenotype of naphthalene animals is less severe than the spin (3) and spin2 phenotypes as foot lesions were not observed in the naphthalene mice. The foot lesions observed in the spin mice were associated with the development of splenomegaly and an increased number of erythroid and myeloid cells in the spleen, as well as a reduction in mature B cell numbers in the peripheral blood, spleen and bone marrow. Spontaneously occurring motheaten (me) and viable motheaten (me-v) mutants are immunodeficient and exhibit multiple defects stemming from increased inflammation, including alopecia, glomerulonephritis, dermatitis, inflammation of the paws, and interstitial pneumonitis which ultimately causes death by 3 and 9 weeks of age in Ptpn6^me/me and Ptpn6^me-v/me-v mice, respectively. The phenotype of the naphthalene animals is significantly less severe than the Ptpn6^me-v allele, which encodes a SHP1 protein with approximately 20% catalytic activity (4). It is likely that the SHP1 protein encoded by the naphthalene allele retains catalytic activity that is greater than 20% of normal, and greater than the SHP1 protein encoded by the spin and spin2 alleles.

Primers

PCR Primer
Naphthalene_pcr_F: AGCGGGAGGGTACGTGATATTC
Naphthalene_pcr_R: TGGAAAGCATCTCCACCAAG

Sequencing Primer
Naphthalene_seq_F: GAGGGTACGTGATATTCCCATACTC
Naphthalene_seq_R: GGGCAAGCCATCCCTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 415 nucleotides is amplified (chromosome 6, - strand):

1   tggaaagcat ctccaccaag ggtgaggagc cctggggagt gtgtgtgggt gtgagagggg
61  ggcaagccat cccttggcct ttgtctaccc tgaagttccc ctgccaccct tgtccagggc
121 tagactgtga cattgatatc cagaagacca tccagatggt acgagcacag cgctccggca
181 tggtgcagac cgaggcccag tacaagttta tttacgtggc cattgcccag ttcatcgaaa
241 cgaccaagaa gaaactggag atcatacaag tgtgtccgga gtggggctgg tgggtggtag
301 gggagtgtgg gcatcaccta gtcctgctgg taccaccatc ctcccaccgc acctttgccc
361 acagtcccag aagggccagg agtcggagta tgggaatatc acgtaccctc ccgct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Yang, J., Liu, L., He, D., Song, X., Liang, X., Zhao, Z. J., and Zhou, G. W. (2003) Crystal Structure of Human Protein-Tyrosine Phosphatase SHP-1. J Biol Chem. 278, 6516-6520.

  2. Poole, A. W., and Jones, M. L. (2005) A SHPing Tale: Perspectives on the Regulation of SHP-1 and SHP-2 Tyrosine Phosphatases by the C-Terminal Tail. Cell Signal. 17, 1323-1332.

  3. Croker, B. A., Lawson, B. R., Berger, M., Eidenschenk, C., Blasius, A. L., Moresco, E. M., Sovath, S., Cengia, L., Shultz, L. D., Theofilopoulos, A. N., Pettersson, S., and Beutler, B. A. (2008) Inflammation and Autoimmunity Caused by a SHP1 Mutation Depend on IL-1, MyD88, and a Microbial Trigger. Proc Natl Acad Sci U S A. 105, 15028-15033.

  4. Kozlowski, M., Mlinaric-Rascan, I., Feng, G. S., Shen, R., Pawson, T., and Siminovitch, K. A. (1993) Expression and Catalytic Activity of the Tyrosine Phosphatase PTP1C is Severely Impaired in Motheaten and Viable Motheaten Mice. J Exp Med. 178, 2157-2163.