Phenotypic Mutation 'emptyhive' (pdf version)
List |< first << previous [record 14 of 132] next >> last >|
Alleleemptyhive
Mutation Type nonsense
ChromosomeX
Coordinate60,269,987 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Atp11c
Gene Name ATPase, class VI, type 11C
Synonym(s) Ig, A330005H02Rik
Chromosomal Location 60,223,290-60,592,698 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous or hemizygous for an ENU mutation exhibit decreased B cells associated with arrested adult B cell lymphopoiesis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001001798; MGI: 1859661

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Q655* in Ensembl: ENSMUSP00000033480 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 380 7e-17 PFAM
low complexity region 693 709 N/A INTRINSIC
Blast:PTPc_DSPc 737 842 N/A BLAST
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
hematopoietic system
homeostasis/metabolism
immune system
liver/biliary system
reproductive system
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Gene trapped(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
18nih30a APN X 36608577 critical splice donor site
ambrosius APN X 36608577 critical splice donor site
IGL00578:Atp11c APN X 60240817 missense probably damaging 1.00
IGL01702:Atp11c APN X 60269903 missense probably damaging 0.96
hit UTSW X nonsense
spelling UTSW X 60290036 missense probably damaging 1.00
R1551:Atp11c UTSW X 60236712 critical splice acceptor site probably null
R2134:Atp11c UTSW X 60276783 missense probably damaging 1.00
R3687:Atp11c UTSW X 60281644 missense probably benign 0.07
R3688:Atp11c UTSW X 60281644 missense probably benign 0.07
R4496:Atp11c UTSW X 60280744 missense probably damaging 0.97
Mode of Inheritance X-linked Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 034370-JAX
Last Updated 2018-10-25 5:15 PM by Diantha La Vine
Record Created unknown
Record Posted 2011-04-29
Phenotypic Description
Figure 1. (a) Frequencies of CD19+ and Thy1.2 blood lymphocytes in the emptyhive pedigree. Percentages (b, c) and numbers (d) of B cell subsets in bone marrow (b) and spleen (c). Hardy fractions in bone marrow (A-F) were gated as follows: A (B220+CD43+BP-1-CD24-); B (B220+CD43+BP-1-CD24+); C (B220+CD43+BP-1+CD24+); D (B220+CD43-IgM-IgD-); E (B220+CD43+IgM-IgD+); F (B220+CD43-IgM+IgD+). IgM+ splenocytes were divided into the following subsets: T1 (CD93+CD23-); T2CD93+CD23+IgMint); T3 (CD93+CD23+IgMhi); MZ (CD93-CD23-IgMhiCD21hi); Fo (CD93-CD23+). (e) Frequencies of peritoneal B-2 (CD19+B220hi), B-1 (CD19+B220lo-int), B-1a (CD5+CD43+) and B-1b (CD5-CD43-) lymphocytes. (f) IgM allotype expression on CD19+ blood lymphocytes from wild-type and emptyhive mice on a (C57BL/6 x BALB/c) F2 (IgMa/b) background. Figure reproduced from reference (2).
Figure 2. Immunoglobulin secretion in emptyhive mice. (a) Total immunoglobins as measured in the serum of 12-24 week-old naive mice. NP-specific antibodies were measured 7, 14 or 28 days after immunization of 12 week-old mice with NP-Ficoll (b) or alum precipitated NP-CGG (c). Different capture antigens were used to discriminate between total (NP23-BSA) and high affinity (NP4-BSA) IgG1 in response to NP-CGG. Figure reproduced from reference (2).

The emptyhive mutation was discovered while screening the blood of ENU-mutagenized G3 mice using flow cytometry (1).  Several mice from common ENU-treated founders displayed a severe reduction in cluster of differentiation (CD) 19+ cells, indicating a lack of peripheral B cells (Figure 1a) (2).  Amongst B cell progenitors in the bone marrow, emptyhive mutants had reduced numbers of cells beginning at the pre-pro-B to pro-B transition (Hardy fraction A to B, equivalent to Basel pro-B to pre-B-I) (Figure 1b) (3;4), with a severe deficiency of immature B cells (Hardy fraction E). In the spleen, emptyhive mice had one-tenth the normal number of CD19+ cells, largely due to a lack of follicular and transitional subsets (Figure 1c, 1d), although numbers of marginal zone (MZ) B cells and Thy1.2+ cells were normal. Frequencies of B-1 cells, the predominant population of B cells in the peritoneal cavity, were reduced by a factor of three in mutant mice (Figure 1e), while the frequency of peritoneal B-2 cells was reduced by a factor of six.  B cells in the blood of mutant mice had undergone normal allelic exclusion at the Igh locus (Figure 1f).  Remaining B cells are able to produce all major immunoglobulin isotypes (Figure 2a), and can generate specific antibodies to T-independent and T-dependent immunogens (see the screens for T-independent and T-dependent B cell responses)(Figure 2b, 2c).  Mice produce neutralizing antibody to Rift Valley Fever Virus (In Vivo RVFV Susceptibility Screen). 

 

Figure 3. A cell-intrinsic failure of B cell development. (a) A 1:1 mix of mutant (CD45.2) and 25 wild-type (CD45.1) bone marrow was used to reconstitute irradiated Rag1 mutant recipients, and lymphocyte repopulation in blood was measured eight weeks later. Unmixed bone marrow (b, c) or E16.5 fetal liver cells (c) from either mutant or wild-type recipients, and reconstitution of splenic and peritoneal B cell subsets was analyzed eight weeks later. PC, peritoneal cavity. (d) Bone marrow chimeras were immunized with NP-Ficoll 8 weeks after reconstitution, and NP-specific immunoglobulin titers were measured 7 and 14 days later. Figure reproduced from reference (2).
Figure 4. Intact B lymphopoiesis in fetal liver. Percentages (a) and absolute numbers (b) of pro/preB (220+Igm-) and immature (B220+IgM+) B cells in the fetal liver of E18.5 embryonic siblings from Atp11cemp/Y x Atp11c+/emp matings. Figure reproduced from reference (2).

The emptyhive defect is intrinsic to B cells as emptyhive bone marrow or fetal liver cells failed to reconstitute B cells in irradiated Rag1 mutant mice (see the record for maladaptive) lacking B and T lymphocytes or wild type mice (Figure 3a-c).  Recipients receiving emptyhive cells also failed to produce specific antibody after immunization with NP-Ficoll (Figure 3d).  Although emptyhive fetal liver cells were unable to reconstitute any B cell lineage in irradiated adult recipients, the B cell developmental defect observed in emptyhive animals is restricted to the bone marrow as emptyhive embryos displayed normal fetal B cell development in the liver (Figure 4). 

 

Figure 5. Hyperbilirubinemia, cholestasis and dystocia in emptyhive mice. (A) Plasma pigmentation in emptyhive mice. (B) Quantitation of total and direct bilirubin in plasma. (C) Total bile acids as measured from the plasma of mutant and littermate control mice. Mutant and control males were fed with a cholic acid supplement or control diet, and monitored for mortality (D). Gall bladder distention (E) and jaundice (F) as observed in littermates on a cholic acid diet for 13 days. (G) Survival curve of homozygous and heterozygous mutant female littermates following pregnancies to hemizygous mutant or wild type males. Data taken from (5).

Emptyhive mice do not appear to have defects in the development of T cells, natural killer (NK) cells or macrophages.  Peritoneal macrophages isolated from homozygous emptyhive mice respond normally to stimulation by Toll-like receptor (TLR) ligands (TLR Signaling Screen). 

 

In addition to their B cell defects, emptyhive animals are hyperbilirubinemic and display elevated levels of cholic acid in their serum (5).  Although these animals display only mild liver pathology, cholestatic disease is exacerbated when given a cholic acid supplemented diet.  In addition, the majority of homozygous females die of dystocia (Figure 5).

 

Emptyhive is allelic to spelling, ambrosius and 18NIH30a (2;6).

Nature of Mutation
Figure 6. The emptyhive phenotype is caused by a recessive mutation of Atp11c. (a) Chromosomal mapping of the emptyhive phenotype. (b) Sequence trace of the mutated nucleotide (C2113T, Q655*) in Atp11c as detected in emptyhive hemizygous males.

To identify the mutation responsible for the emptyhive phenotype, mutant males were outcrossed to C3H/HeN females and backcrossed to their F1 daughters.  Phenotypic linkage to the X chromosome was detected (maximum LOD score of 8.37 at DXMit68) (Figure 6a), and fine mapping with a further 105 meioses confined the mutation to a 13.51Mb interval between DXMit68 and DXMit74. Coding exons and flanking splice junctions of the 81 annotated protein-encoding genes in the mutant interval were sequenced by capillary sequencing, with 85.6% high-quality coverage.  AC to T transition at position 2113 of the Atp11c transcript, in exon 19 of 30 total exons, was identified (Figure 6b).

 

2098 GACAAGCTGCAAGATCAGGCTGCAGAGACCATT

650  -D--K--L--Q--D--Q--A--A--E--T--I-

 

The mutated nucleotide is indicated in red lettering, and converts glutamine 655 of the ATP11C protein to a stop.

 

Protein Prediction

ATP11C is an 1129 amino acid 10 transmembrane-spanning member of the P4-ATPase family of aminophospholipid transporters.  ATP11C is highly conserved with 94.8% identity with its human homologue, and has two predicted isoforms.  Isoform 2 is missing amino acids 833-835 and has a different C-terminus of 20 amino acids starting at amino acid 1097 (Uniprot)(7).

 

ATPases (or ATP synthases) are membrane-bound enzyme complexes/ion transporters that combine ATP synthesis and/or hydrolysis with the transport of protons across a membrane. ATPases can harness the energy from a proton gradient, using the flux of ions across the membrane via the ATPase proton channel to drive the synthesis of ATP.  The P-type ATPases are a large family of transmembrane transporters acting on charged substances. The distinguishing feature of the family is the formation of a phosphorylated intermediate (aspartyl-phosphate) during the course of the reaction.  Another common name for these enzymes is the E1-E2 ATPases based on two major conformations: E1 (unphosphorylated) and E2 (phosphorylated).  The P-type ATPases can be divided into five subfamilies based on sequence conservation (8). The type 4 P-type ATPases (P4-ATPases) forms a distinct group based on sequence divergence and their proposed role in transport of phospholipid molecules rather than cations (9).  The P4-ATPases lack the cation-interacting amino acid residues in transmembrane 4 (M4) and 6 (M6) that are important in cation binding, and that are present in most P-type ATPases.  Instead, P4-ATPases contain hydrophobic residues in this region, which may interact with hydrophobic lipids and aid their transport (10).  In mammals, fourteen P4-ATPases exist (9).  ATP11C is most closely related to ATP11A and ATP11B (7).

 

The P4-ATPases are predicted to contain 10 transmembrane segments with the N- and C-termini facing the cytosol (Figure 7).  By analogy to the crystal structure for a Ca2+ ATPase (SERCA1), the cytosolic N-terminal tail and the loop between transmembrane domains 2 (M2) and 3 (M3) forms the actuator (A) domain, while the large cytosolic loop between M4 and M5 forms the phosphorylation (P) and the nucleotide-binding (N) domains (11).  The ATP11C transmembrane domains occur at amino acids 57-77, 84-104, 288-308, 344-364, 877-897, 906-926, 953-973, 989-1009, 1024-1044, and 1067-1087 (Uniprot).  In SERCA1, Ca2+ binding sites are formed by side chains and backbone carbonyls from M4, M5, M6 and M8.  M4 is unwound in this region due to a conserved proline (P356 for ATP11C), which is a key structural feature of P-type ATPases.  The P domain contains the canonical aspartic acid phosphorylated during the reaction cycle (D409 in ATP11C), and is composed of two parts widely separated in sequence that assemble into a seven stranded parallel β-sheet with eight short associated α-helices, forming a Rossmann fold.  The N domain is inserted between the two segments of the P domain, and is formed of a seven strand antiparallel β-sheet between two helix bundles. This domain contains the ATP binding pocket.  Two Mg2+ binding sites (amino acids 816 and 820) form part of the active site, and are necessary for ATP hydrolysis.  The A domain consists of a distorted jelly roll structure and two short helices, and is pivotal in transposing the energy from the hydrolysis of ATP in the cytoplasmic domains to the transport of substrate in the transmembrane domains.  As part of the reaction cycle, the A domain dephosphorylates the P domain using a highly conserved TGES motif.  The folding pattern and the locations of the critical amino acids for phosphorylation in P-type ATPases are similar to the haloacid dehalogenase fold characteristic of the haloacid dehalogenase (HAD) superfamily (8)

 

ATP11C has several predicted phosphorylation sites occurring at Y258, S442 and S1105, and ATP11C phosphorylated peptides fragments have been isolated from mouse liver in a large-scale phosphorylation analysis of mouse liver(12).

 

A number of P4-ATPases have been shown to form complexes with the CDC50 family of proteins.  These proteins are necessary for the appropriate transport of P4-ATPases from the ER (13-15), and recent data suggests they form a critical part of the active lipid transporter in yeast by rendering the ATPase competent for phosphorylation at the catalytically important aspartate residue (16).   CDC50 proteins are predicted to have two transmembrane domains, and a large glycosylated extracellular domain (17).

 

Figure 7. Membrane topology of P4-ATPases modeled after the structure of SERCA1 with 10 transmembrane (TM) segments and distinct actuator (A), phosphorylation (P) and nucleotide binding (N) domains. P4-ATPases are proposed to flip phospholipids to the cytosolic membrane layer. Motifs that are important for the catalytic function of P-type ATPases are indicated. Conversion of ATP to ADP by the N-domain leads to phosphorylation of the P-domain and transport of substrate. The A-domain dephosphorylates the P-domain. P4-ATPases can form complexes with CDC50 proteins (pink), which are predicted to have two transmembrane domains and a large, glycosylated ectoplasmic domain. Phosphatidylserines are indicated in dark blue, phosphatidylethanolamine in dark green, and phosphatidylcholine in orange. Although PC is typically localized to the extracellular side of the plasma membrane, it may also be a P4-ATPase substrate. The residue mutated in emptyhive mice is labeled in red. This image is interactive. Click on the image to view other mutations found in ATP11C (red). Click on the mutations for more specific information.   

The emptyhive mutation causes a truncation of the ATP11C protein prior to the fifth transmembrane domain, which should result in a non-functional protein. 

The P4-ATPases are predicted to contain 10 transmembrane segments with the N- and C-termini facing the cytosol (Figure 2). By analogy to the crystal structure for a Ca2+ ATPase (SERCA1), the cytosolic N-terminal tail and the loop between transmembrane domains 2 (M2) and 3 (M3) forms the actuator (A) domain, while the large cytosolic loop between M4 and M5 forms the phosphorylation (P) and the nucleotide-binding (N) domains (5). The ATP11C transmembrane domains occur at amino acids 57-77, 84-104, 288-308, 344-364, 877-897, 906-926, 953-973, 989-1009, 1024-1044, and 1067-1087 (Uniprot). In SERCA1, Ca2+ binding sites are formed by side chains and backbone carbonyls from M4, M5, M6 and M8. M4 is unwound in this region due to a conserved proline (P356 for ATP11C), which is a key structural feature of P-type ATPases. The P domain contains the canonical aspartic acid phosphorylated during the reaction cycle (D409 in ATP11C), and is composed of two parts widely separated in sequence that assemble into a seven stranded parallel β-sheet with eight short associated α-helices, forming a Rossmann fold. The N domain is inserted between the two segments of the P domain, and is formed of a seven strand antiparallel β-sheet between two helix bundles. This domain contains the ATP binding pocket. Two Mg2+ binding sites (amino acids 816 and 820) form part of the active site, and are necessary for ATP hydrolysis. The A domain consists of a distorted jelly roll structure and two short helices, and is pivotal in transposing the energy from the hydrolysis of ATP in the cytoplasmic domains to the transport of substrate in the transmembrane domains. As part of the reaction cycle, the A domain dephosphorylates the P domain using a highly conserved TGES motif. The folding pattern and the locations of the critical amino acids for phosphorylation in P-type ATPases are similar to the haloacid dehalogenase fold characteristic of the haloacid dehalogenase (HAD) superfamily (2)
 
ATP11C has several predicted phosphorylation sites occurring at Y258, S442 and S1105, and ATP11C phosphorylated peptides fragments have been isolated from mouse liver in a large-scale phosphorylation analysis of mouse liver (6).
 
A number of P4-ATPases have been shown to form complexes with the CDC50 family of proteins. These proteins are necessary for the appropriate transport of P4-ATPases from the ER (7-9), and recent data suggests they form a critical part of the active lipid transporter in yeast by rendering the ATPase competent for phosphorylation at the catalytically important aspartate residue (10).  CDC50 proteins are predicted to have two transmembrane domains, and a large glycosylated extracellular domain (11).
 
The emptyhive mutation causes a truncation of the ATP11C protein prior to the fifth transmembrane domain, which should result in a non-functional protein. 
Expression/Localization

Northern blot analysis of several human tissues detected a 7.4-kb ATP11C transcript that was expressed ubiquitously, and a minor 7.3-kb transcript that was expressed in some tissues, including liver and pancreas.  Expression of ATP11C transcripts appear to be higher in liver, pancreas, and kidney, and lower in the brain and skeletal muscle (7).  These results correlate to expression data from SymAtlas where ATP11C mRNA levels appear to be ubiquitously expressed in both human and mouse tissues and cells, but are noticeably higher in liver.  The isolation of phosphorylated ATP11C peptide fragments from mouse liver further confirms that ATP11C is expressed in this tissue (12).  In the mouse, expression levels are slightly elevated in NK cells, osteoclasts and bone marrow macrophages (SymAtlas).   

 

The ATP11C protein is predicted to localize to the plasma membrane (MultiLoc), although the closest yeast homologue, Drs2p, has been localized to the late Golgi complex (18;19).

Background

Phospholipid asymmetry appears to be a critical feature of the eukaryotic cell plasma membrane [reviewed by (20)].  The four major classes of phospholipids are segregated on opposite layers of the bilayer based on the structure of the lipid head group. The choline containing phospholipids, sphingomyelin and phosphatidylcholine (PC), are enriched in the external layer, whereas the primary amine-containing phospholipids, phosphatidylethanolamine (PE) and phosphatidylserine (PS), are sequestered on the cytoplasmic layer.  Other minor phospholipids such as phosphatidic acid and the phosphoinositides are also localized primarily to the inner layer of the membrane.  Cholesterol is distributed equally between the two layers of the membrane, whereas other neutral lipids such as glycolipids are enriched on the outer surface.  The non-random distribution of phospholipids is crucial for many physiological processes, including signal transduction, cell morphology, cell movement, activity of membrane proteins, and vesicle biogenesis (9)

 

The localization of PS to the cytoplasmic layer of plasma membrane appears to be important for membrane budding and clathrin-coated vesicle formation during post-Golgi transport and endocytosis based on studies in yeast (21).  PS in the cytoplasmic leaflet also activates protein kinase C β (PKCβ; see the record for Untied), and provides a docking site for other signaling proteins (22).  The regulated dissipation of lipid asymmetry and externalization of PS can trigger a variety of physiological responses, ranging from blood coagulation, myotube formation and sperm capacitation to phagocytic recognition, and clearance of apoptotic cells.  During the early stages of cell death and during certain forms of cell activation such as platelet activation, PS redistributes to the exoplasmic leaflet where it can be recognized by specific PS receptors or blood proteins like clotting factor VIII (23).  Macrophages bear receptors that recognize exoplasmic PS as “eat-me” signals (24;25).  The vaccinia virus appears to take advantage of this system as vaccinia virus entry into cells is critically dependent on the presence of exposed PS in the viral membrane (26).  Viable cells also display PS during certain conditions independent of apoptosis, notably pre-B cells that have received pre-BCR signals, MZ B cells (27), and some B cell lymphomas (28).

 

Although no P4-ATPase has been shown to display flippase activity in reconstitution experiments with purified enzyme, functional studies in yeast, C. elegans, plants and mammals suggests that these proteins are responsible for transporting phospholipids, particularly PS, through the membrane bilayer although the exact mechanism for this transport remains unclear (13;15;29;30).  The specific localization of phospholipids in membranes is dependent on the presence of functional P4-ATPases, and the catalytic phosphorylation of these transporters is stimulated by the presence of phospholipids in reconstituted systems (16).  However, in certain situations, it is possible that actual lipid transport is carried out by ATP-binding cassette (ABC) transporters, which are transmembrane proteins that utilize the energy of ATP hydrolysis to carry out certain biological processes including translocation of various substrates including metabolic products, lipids and sterols, and drugs across membranes as well as non-transport-related processes.  ABC transporter activity can be regulated indirectly by P4-ATPases (31) (see below). 

 

Only a few diseases and phenotypes are associated with P4-ATPase genes in mammals.  Mutations in the ATP8B1 gene in humans result in progressive familial intrahepatic cholestasis type 1 (PFIC1; OMIM #211600), benign recurrent intrahepatic cholestasis type 1 (BRIC1; OMIM #243300), and intrahepatic cholestasis of pregnancy (ICP; OMIM #147480).  These disorders are characterized by impaired bile flow from the liver, resulting in liver damage (32).  ATP8B1-deficient mice also exhibited impaired bile flow, although these animals did not display liver disease (29).  The ATP8B1 transporter appears to be necessary for appropriate PS localization in the canicular membrane formed by bile-secreting hepatocytes.  Loss of PS from the extracellular membrane due to ATP8B1 mutations, results in loss of resistance of the canicular membrane to the detergent activity of bile, extracting of membrane components and loss of activity of the major bile salt export pump, ABCB11 [reviewed in (9)].  In addition, humans and mice with ATP8B1 mutations display hearing loss associated with progressive degeneration of cochlear hair cells (33), as well increased incidences of pneumonia due to an overabundance of the phosopholipid cardiolipin in lung fluid.  ATP8B1 is needed to internalize cardiolipin in lung epithelia (34).  P4-ATPases also appear to have roles in sperm function and obesity.  ATP8B3 is implicated in sperm capacitation in mice, although knockout animals do not exhibit severe fertility defects (35), while a novel P4-ATPase, named FetA (flippase expressed in testis splicing form A) is highly expressed in the testes and may have a role in acrosome formation, a process that involves intracellular formation and fusion (36).  Both ATP10A and ATP10D are implicated in obesity, type 2 diabetes, and fatty liver disease in the mouse.  C57BL/6 animals contain a mutation in the Atp10d locus that results in a stop codon, which may be partially responsible for the fat-prone phenotype of this strain (37), while mice heterozygous for the maternally imprinted Atp10c gene are hyperinsulinemic, insulin-resistant and have an altered insulin-stimulated response in peripheral tissues, which may be caused by abnormal transport of proteins necessary for glucose metabolism (38;39).  Interestingly, lack of a maternal contribution to the genome at the imprinted domain on proximal chromosome 15 in humans causes Angelman Syndrome (AS; OMIM #105830) associated with neurobehavioral anomalies and sometimes obesity.  This portion of the genome contains the ATP10C gene and expression of ATP10C is absent from many patients [reviewed in (9)].  Prader-Willi syndrome (PWS; 176270) is a clinically distinct obesity disorder resulting from paternal deletion of the same 15q11-q13 region. 

 

Figure 8. B cell ontogeny. Conventional B cell differentiation occurs in the bone marrow and spleen. In the bone marrow, development progresses from stem cells through the pro-B cell, pre-B cell and immature pre-B cell stages. Steps upstream of the pro-B stage are not shown for simplicity. During this differentiation, VDJ rearrangements at the immunoglobulin locus result in the generation and surface expression of the pre-B cell (pre-BCR), comprising of an Igm heavy (H) chain and surrogate light chains (VpreB and λ-5). Pre-BCR signaling is necessary for proliferation and further differentiation resulting in expression of a muture BCR, composed of rearranged heavy and light (L) chains, that is capable of binding antigen. Cells successfully completing ths checkpoint leave the bone marrow and proceed through two transitional (T) stages before becoming mature follicular B cells or marginal-zone B cells. The gray boxes list membrane markers and the stage of immunoglobin chain rearrangement associated with each step. Also listed are mouse knockouts (see text) and the resulting block in B cell develpment. D, diversity; J, joining; V, variable; SLC, surrogate light chain.

B cell progenitors first arise in fetal liver, then in bone marrow shortly after birth, and give rise to three major mature populations (40).  Marginal zone (MZ) B cells localize to the splenic marginal zone and respond to blood-borne antigens independently of T cell help (41).  Follicular B cells, by contrast, respond to protein antigens in a T cell-dependent manner, and progressively undergo immunoglobulin isotype switching and affinity maturation. B-1 B cells comprise a much smaller population, which predominates in the pleural and peritoneal cavities and contributes most of the serum IgM during the early phases of infection (42).  Whereas MZ and B-1 B cells are predominantly self-renewing, follicular B cells require constant replenishment from bone marrow.  The development of B cells is characterized by the differential expression of marker proteins, and by the sequential recombination of the immunoglobulin gene loci [reviewed in (43)] (Figure 8).  In the bone marrow, lymphoid progenitor cells or prepro-B cells receive signals from bone marrow stromal cells, such as interleukin 7 (IL-7) to begin B cell development.  The developmental of early B lymphopoiesis is regulated by a network of key transcription factors that include PU.1, Ikaros, Bcl11a (a zinc finger transcription factor), E2A (a helix-loop- helix protein), EBF (early B cell factor) and the paired boxprotein, Pax5 (44). Prepro-B cells become pro-B cells as they begin to rearrange their immunoglobulin heavy (IgH) chains in a process known as V(D)J recombination mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive).  On the H chromosome, the diversity (D) and joining (J) gene segments are recombined together, and the cells transition into the early pro-B stage and express the CD45 (B220) marker (see the record for belittle).  Joining of a variable (V) segment to the D-J segment completes the late pro-B cell stage.  Successful VDJ recombination gives rise to the Igμ chain.  Two Igμ chains combine with two surrogate light chains (SLCs), composed of λ-5 and Vpre5.  Association with the signaling subunits Igα and Igβ completes the pre-B cell receptor (BCR) complex.  Cells expressing the pre-BCR are competent for pre-BCR signaling, which initiates proliferation, further differentiation, and eventually downregulates expression of the pre-BCR.  Cycling B cells expressing the pre-BCR complex are known as large pre-B cells.  Large pre-B cells downregulate both the B cell marker CD43 as well as the pre-BCR to become non-cycling small pre-B cells.  At this stage rearrangement of the immunologlobin light (IgL) chain by the RAG1-RAG2 complex occurs to form the BCR (or surface IgM) characteristic of immature B cells.  These cells leave the bone marrow to further mature in the spleen.  The BCR is necessary for mature B cell responses such as antibody production.  

Figure 9. Pre-BCR and BCR signaling. Pre-BCR engagement results in the activation of SYK (spleen tyrosine kinase), which together with Src-family kinases (LYN, FYN, BLK), phosphorylates many substrates and triggering signaling pathways that are involved in both proliferation and differentiation of pre-B cells. These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP). PI3K activation results in the generation of phosphatidylinosital-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3- phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway pathway suppresses recombination-activating gene 1 (RAG1) and RAG2 expression, blocks Igk (the k chain of the immunoglobin light chain) gene recombination, and induces cell proliferation. SYK also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and phospholipase Cγ2 (PLCγ2). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igk recombination. SLP65 also modulates PKB activity either directly or by altering the activity of SYK, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP) and altering PIP3 levels. Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK . These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-g2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-g2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. Image is interactive. Click to view mutations.

Blocks in adult B cell development are observed in several mouse mutant models (Figure 9), including animals that are deficient for factors necessary for VDJ recombination, components of the pre-BCR complex, and the pre-BCR/BCR signal transduction machinery.  While mutations in Pax5, Rag1, Rag2, Igμ, Igα, and Igβ lead to an absolute block in B cell development during the pro-B stage (43-46), mutations in the SLC components result in phenotypes that are very similar to those observed in homozygous emptyhive mice, with an incomplete block at pro- to pre-B cell transition (47;48).  Similar blocks in B cell development are observed in Foxp1 knockout animals, which have reduced expression of Rag1 and Rag2 (49), and in mice deficient for the BCR signal transduction components Btk (Bruton’s tyrosine kinase), Syk (spleen tyrosine kinase), BLNK (B cell linker; see the record for busy), BCAP (B cell adaptor for phosphatidylinositol 3-kinase), the guanine nucleotide exchange factors Vav1/Vav2/Vav3, the p85 subunit of PI3K (phosphatidylinositol 3-kinase), PKCβ, Bcl10, CARMA1 (caspase recruitment domain family, member 11; see the record for king), MALT1 (mucosa-associated lymphoid tissue translocation gene 1) and PLC-γ2 (phospholipase C γ2; see the record for queen) (50).  In humans, mutations in BTK, BLNK, λ-5, Igμ, Igα, and Igβ cause agammaglobulinemia and severe immunodeficiency (OMIM #300755#601495) [reviewed by (51)].  Many leukemias are also caused by mutations in these genes (43)

 
Putative Mechanism
Figure 10. Partial correction of the emptyhive phenotype with a BCR transgene. (a) λ5 (CD179b) expression on the surface of B220+CD43+ bone marrow lymphocytes. Shaded histograms represent rat IgGa isotype control, while solid histograms show λ5 staining. The emptyhive mutation was combined with the MM4 transgene (b) or the LC2 light chain transgene, VH10tar knockin allele, or both (SWHEL) (c). *P< 0.05, ***P < 0.001. Figure reproduced from reference (2).

Despite the similarities in phenotype between emptyhive mice and animals with mutations in SLC components, λ-5 is appropriately expressed in emptyhive bone marrow (Figure 10a).  However, the presence of a recombined BCR transgene in emptyhive mice, rendering the pre-BCR complex redundant, partially corrected B cell development in these animals (Figure 10b,c).  Significant correction of the emptyhive B cell deficiency was achieved only in the presence of both a heavy chain knockin allele and light chain transgene implying that the arrest in emptyhive B cell development is coincident with pre-BCR selection, but is not caused by faulty recombination and expression of heavy or light chain genes alone (Figure 10c).  These findings are consistent with similar experiments performed in allelic ambrosius mice (6) and suggest that bypassing pre-BCR signaling alleviates, but does not eliminate the need for ATP11c.

 

Figure 11. No defect in IL-7R signaling. (a) FACS-sorted B cell precursors were cultured ex vivo in the presence or absence of IL-7, and percentages of 7-AAD-lymphoblasts (FSChiSSChi) were measured at daily intervals. (b) Splenic B cell numbers in emptyhive mice with combined mutation of Flt3. Figure reproduced from reference (2).

Emptyhive mice display a defect in adult B cell development, but have normal fetal B cell lymphopoiesis that is further evidenced by the normal numbers of MZ and B-1 cells.  As IL-7 is known to be essential for adult, but not fetal B cell development (52), IL-7R signaling was examined in mutant progenitors.  IL-7R signaling appeared intact in these cells (Figure 11a).  In the absence of IL-7, signaling through the receptor tyrosine kinase FLT3 (see the record for warmflash) is thought to account for residual B lymphopoiesis (53), perhaps explaining the remaining B cells present in emptyhive mice.  However, emptyhive;Flt3 double mutant mice had similar numbers of CD19+ splenocytes as emptyhive single mutants (Figure 11b).  Despite these results, experiments using allelic ambrosius mice suggest that the presence of functional ATP11C is required for normal IL-7R signaling as the mutation abolished the proliferative effects of transgenic IL-7 on pro-B and pre-B cells in the bone marrow (6).   

 

Figure 12. Surface expression of phosphatidylserine and GM1 ganglioside. (a) Histograms of Annexin-V and cholera toxin (CTX) staining on the surface of 9-AAD-B220+ λ5+ (Annexin-V) and B220+λ5+ (CTX) bone marrow lymphocytes from wild-type (shaded gray) or mutant (open, black) mice. (b) Mean fluorescence intensity values fro forward scatter (FSC), Annexin-V and CTX. Figure reproduced from reference (2).
Figure 13. Genetic modulation of PIP3 availability does not affect B cell deficiency. Mutations known to either increase (a) (Inpp5dstyx, Ptpn6spin) or decrease (b) (Cd19cre, Cd45belittle) PIP3 signaling were combined with the emptyhive mutation, and B cell frequencies were measured in the blood of double mutant mice. Figure reproduced from reference (2).

Like other members of the P4-ATPase family, ATP11C may be involved in phospholipid transport and maintaining membrane asymmetry.  Increased PS on the cell surface and consequent PS-mediated phagocytosis could account for diminished numbers of B cells in Atp11c mutant mice. PS expression on λ-5 expressing cells was examined using Annexin V, which binds to PS, yet no increase in surface expression was observed (Figure 12a,b).  Experiments using pro-B cells from allelic ambrosius mice, however, suggest that ATP11c deficiency results in decreased PS translocation into the inner layer of the plasma membrane, although steady-state levels of cytoplasmic PS remains similar.  The percentage of Annexin V+ pre-B cells is increased, suggesting increased apoptosis (6).

 

Changes in PS asymmetry or rate of translocation to the inner cytoplasmic surface of the membrane may also affect the presence and localization of lipid rafts in the plasma membrane of developing B cells, thus disrupting the localization of signaling molecules to the membrane and inhibiting pre-BCR and/or IL-7R signaling (54-56).  In developing B cells, disruption of lipid composition in the plasma membrane may affect PI3K signaling downstream of the pre-BCR receptor.  In response to BCR signaling, PI3K phosphorylates phosphatidylinositol-4,5-biphosphate to generate phophatidylinositol-3,4,5-triphosphate (PIP3), which is necessary for recruitment of critical signaling molecules to the membrane (57).  A defect in PI3K signaling may also underly a specific role for ATP11C in pre-BCR versus BCR signaling as the pre-BCR complex has been shown to be physically associated with a larger amount of PI3K than the BCR (58).  Mutation of Cd19, encoding a B cell coreceptor, or Pik3cd, encoding the δ subunit of PI3K, cripples the function of PI3K and generation of PIP3 at the pre-BCR signalosome, resulting in an impairment of MZ and B-1 B cell development (59;60). Conversely, in the absence of the PIP3 phosphatase PTEN, an excess of PIP3 leads to an expansion of MZ and B-1 subsets (59). Since mutations of both positive and negative regulators of PIP3 availability are known to affect B cell development (61), and since phosphatidylinositol asymmetry may be disrupted in emptyhive progenitors, the emptyhive mutation was combined with mutations of Cd19, Cd45, Inpp5d (see the record for styx) and Ptpn6 (see the record for spin). Neither genetic enhancement (Inpp5d, Ptpn6 mutations) nor diminishment (Cd19, Cd45 mutations) of PIP3 availability altered the emptyhive phenotype (Figure 13), implying that a disruption of phosphatidylinositol asymmetry was an unlikely cause of B cell deficiency in Atp11c mutant mice.

 

Figure 14. The emptyhive mutation prevents progenitor B cells in adult bone marrow from becomingpre-B cells. See text for details.

The hyperbilirubinemia, tendency to cholestasis, and dystocia observed in Atp11c mutant mice suggest that ATP11C functions in non-hematopoietic tissues.  The cholestatic phenotype of Atp11c mutant mice resembles other mouse models of PFIC including Atp8b1, Abcb11 and Abcb4 mutants (62-64), but with notable distinctions. Chief among them is hyperbilirubinemia, which is observed in Atp11c and Abcb4 mutants (64), but not in Abcb11 or Atp8b1 mutants (62;63). In addition, an enlargement of the gallbladder is apparent in Atp11c mutant animals after dietary supplement of cholic acid, which is also not observed in Abcb11 or Atp8b1 mutants.  Unlike Abcb4 mutants, plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were not elevated in Atp11c mutants, nor was ductular proliferation apparent, indicating that hepatocyte death and biliary obstruction are more prevalent in Abcb4 mutant mice (64).  ABCB4 is essential for the translocation of phosphatidylcholine from the inner to outer leaflet of the canalicular membrane.  It is possible that like ATP8B1, ATP11C is required for appropriate PS localization in the canicular membrane and that disruption of ATP11C function may affect the activity of the major bile salt export pump, ABCB11.  As loss of ATP8B1 function in mice does not cause liver disease as it does in humans (29;32), these two ATPases may have partially redundant functions in mice.  ATP11C may also regulate ABCB4 function as well.

 

Primers Primers cannot be located by automatic search.
Genotyping
Emptyhive genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Empty(F): 5’- TCTGAAAGGAAGCCAAAGAAAGTGTCATTA -3’
Empty(R): 5’- AGGTTCGATTTACAGCACTGCCAA -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Empty_seq(F): 5’- CCCTATAGAGACCATGTTAGCTTCAG -3’
Empty_seq(R): 5’- CAGCACTGCCAAATAATGTTTGAG -3’
 
The following sequence of 982 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Atp11c) is amplified:
 
133530 t ctgaaaggaa gccaaagaaa gtgtcattat
133561 tctatccttt attcttaaat tctcaaggaa aactactgta tttcctttat ttatttactt
133621 ttctttttat gagacaggat cttagctgtg taggcctggc ttgcctggaa caccctatag
133681 agaccatgtt agcttcagat tctcaatgat ttgcctgcag ctgcctccca tgtgctggga
133741 ttaaagatga gctacagcac tcagcagctt tcctaacatt agaagttcct caatgctaag
133801 agtttactaa tatcccccat atctaattag aatgtttcag ctctttccat tttgccagag
133861 gcaacctgac tataataagg attctagaat tggattgcta gtgagctgta agaatgctta
133921 cttcaacagt ccttcttctc tcatgaattt tagagattaa cgaggtttct ttgtgttttt
133981 aggctgcaag atcaggctgc agagaccatt gaagctctcc atgcagctgg cttaaaagtc
134041 tgggtgctta ctggggacaa gatggaaaca gccaaatcta cttgctatgc ctgccgcctt
134101 ttccaaacca atactgagct cttggaactg accacaaaaa ccattgaaga gagtgaaagg
134161 aaagaagatc gattacatga actgctaata gaatatcgta agaagttgct gcatgaattt
134221 cctaaaagca ctagaagcct taaaaagtaa gaaagtacat ctacttatta atttatacat
134281 tgatccaaat gtaaataaga gattattttt gtagaaagct ctgtttgctg tgatttacta
134341 ttctgtgttg atttttttct tctaagttaa aaccttccct gaggacttgt ctaattctcc
134401 acttgagatt atttgttgct gtatctctct cttaatgtaa aagtcaaaga gatttcgcaa
134461 gatttagtgt caaaactcaa acattatttg gcagtgctgt aaatcgaacc t
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
  57. Payrastre, B., Missy, K., Giuriato, S., Bodin, S., Plantavid, M., and Gratacap, M. (2001) Phosphoinositides: Key Players in Cell Signalling, in Time and Space. Cell. Signal.. 13, 377-387.
  58. Nakamura, T., Koyama, M., Yoneyama, A., Higashihara, M., Kawakami, T., Yamamura, H., Sada, K., Okumura, K., and Kurokawa, K. (1996) Signal Transduction through Mu Kappa B-Cell Receptors Expressed on Pre-B Cells is Different from that through B-Cell Receptors on Mature B Cells. Immunology. 88, 593-599.
  59. Anzelon, A. N., Wu, H., and Rickert, R. C. (2003) Pten Inactivation Alters Peripheral B Lymphocyte Fate and Reconstitutes CD19 Function. Nat. Immunol.. 4, 287-294.
  60. Janas, M. L., Hodson, D., Stamataki, Z., Hill, S., Welch, K., Gambardella, L., Trotman, L. C., Pandolfi, P. P., Vigorito, E., and Turner, M. (2008) The Effect of Deleting p110delta on the Phenotype and Function of PTEN-Deficient B Cells. J. Immunol.. 180, 739-746.
  61. Miosge, L. A., and Goodnow, C. C. (2005) Genes, Pathways and Checkpoints in Lymphocyte Development and Homeostasis. Immunol. Cell Biol.. 83, 318-335.
  62. Wang, R., Salem, M., Yousef, I. M., Tuchweber, B., Lam, P., Childs, S. J., Helgason, C. D., Ackerley, C., Phillips, M. J., and Ling, V. (2001) Targeted Inactivation of Sister of P-Glycoprotein Gene (Spgp) in Mice Results in Nonprogressive but Persistent Intrahepatic Cholestasis. Proc. Natl. Acad. Sci. U. S. A.. 98, 2011-2016.
  63. Pawlikowska, L., Groen, A., Eppens, E. F., Kunne, C., Ottenhoff, R., Looije, N., Knisely, A. S., Killeen, N. P., Bull, L. N., Elferink, R. P., and Freimer, N. B. (2004) A Mouse Genetic Model for Familial Cholestasis Caused by ATP8B1 Mutations Reveals Perturbed Bile Salt Homeostasis but no Impairment in Bile Secretion. Hum. Mol. Genet.. 13, 881-892.
  64. Smit, J. J., Schinkel, A. H., Oude Elferink, R. P., Groen, A. K., Wagenaar, E., van Deemter, L., Mol, C. A., Ottenhoff, R., van der Lugt, N. M., and van Roon, M. A. (1993) Homozygous Disruption of the Murine mdr2 P-Glycoprotein Gene Leads to a Complete Absence of Phospholipid from Bile and to Liver Disease. Cell. 75, 451-462.
 
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Carrie N. Arnold, Christoph Huber, Elaine Pirie, Yu Xia, Pei Lin, David Nemazee, Bruce Beutler
List |< first << previous [record 14 of 132] next >> last >|
Edit History
2011-07-15 10:58 AM (current)
2011-06-20 10:53 AM
2011-05-25 10:25 AM
2011-05-20 4:48 PM
2011-05-20 4:44 PM
2011-05-20 4:40 PM
2011-05-20 4:21 PM
2011-05-20 4:20 PM
2011-05-20 4:14 PM
2011-05-20 4:08 PM
2011-05-20 4:03 PM
2011-05-20 3:55 PM
2011-05-20 3:48 PM
2011-05-20 3:37 PM
2011-05-20 3:28 PM
2011-05-20 11:03 AM
2011-05-16 3:50 PM
2011-05-16 3:50 PM
2011-05-16 3:37 PM
2011-05-16 3:36 PM
2011-05-16 3:36 PM
2011-05-16 3:35 PM
2011-05-16 3:34 PM
2011-05-16 3:33 PM
2011-05-16 3:20 PM
2011-05-16 3:10 PM
2011-05-16 3:06 PM
2011-05-16 3:04 PM
2011-05-16 1:56 PM
2011-05-16 1:56 PM
2011-05-16 1:54 PM
2011-05-16 1:51 PM
2011-04-29 12:33 PM