Phenotypic Mutation 'Chamonix'

• Allele: Chamonix
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 43,409,422 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Siglecg
• Gene Name: sialic acid binding Ig-like lectin G
• Synonym(s): mSiglec-G, A630096C01Rik
• Chromosomal Location: 43,408,204-43,418,358 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002] ; PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005592]
• AlphaFold: Q80ZE3
• SMART Domains: Protein: ENSMUSP00000005592; Gene: ENSMUSG00000030468; AA Change: S200G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
  (Using ENSMUST00000005592)
• Meta Mutation Damage Score: 0.3874
• Is this an essential gene?: Probably nonessential (E-score: 0.077)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Anne Murray
• Record Created: 2019-01-22 7:02 PM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_172900; MGI:2443630

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(3) Gene trapped(3) Targeted(3)

Phenotypic Description

Figure 1. Chamonix mice exhibit increased frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Chamonix phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2358, some of which showed increased frequencies of B1a cells in B1 cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased B1a cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R2358. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The increased B1a cell frequency phenotype was linked by continuous variable mapping to a mutation in Siglecg: an A to G transition at base pair 43,409,422 (v38) on chromosome 7, or base pair 1,230 in the GenBank genomic region NC_000073. Linkage was found with an additive model of inheritance, wherein one variant homozygote and seven heterozygous mice departed phenotypically from four homozygous reference mice with a P value of 0.000858 (Figure 2).  The mutation in Siglecg was presumed causative as the B1a cell phenotype in Chamonix mimics that of other Siglecg mutant alleles (e.g., see Shenandoah).

The mutation corresponds to residue 743 in the mRNA sequence NM_172900 within exon 4 of 12 total exons.

728 AATTACTCAGTTCTGAGCTTTATCCCAGGACTT 195 -N--Y--S--V--L--S--F--I--P--G--L-

The mutated nucleotide is indicated in red. The mutation results in a serine to glycine substitution at position 200 (S200G) in the Siglec-G protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.908).

Protein Prediction

Figure 3. Domain organization of Siglec-G. The Chamonix mutation results in a serine to glycine substitution at position 200 (S200G). Other mutations found in the Siglec-G protein are shown in red. Click on each mutation for more information.

Siglec-G (Siglec-10 in humans) is a member of the CD33-related Siglec (sialic acid–binding immunoglobulin‐like lectin) family of adhesion molecules. Siglecs specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates; Siglec-G preferentially binds α2,3-linked or α2,6-linked sialic acid (α2,3Sia or α2,6Sia).

Siglec-C is a type 1 transmembrane protein with a signal peptide, a sialic-binding V-set Ig-like domain, three C2-set Ig-like domains, a transmembrane domain, and a cytoplasmic tail with two putative immune receptor tyrosine-based inhibitory motifs (ITIMs) and a Grb-2 binding motif (1).

The Chamonix mutation results in a serine to glycine substitution at position 200 (S200G) in the Siglec-G protein; amino acid 200 is within the first C-type Ig domain.

For more information about Siglecg, please see the record Shenandoah.

Putative Mechanism

Siglec-G/-10 is one of two Siglecs expressed by B cells (the other being CD22; see the record for well), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed by (2)]. Siglec-G/-10 is a B1 cell inhibitory receptor that inhibits B cell receptor-associated NF-κB and calcium signaling, subsequently controlling the expansion and survival of B1 cells (1;3-5). The mechanism by which Siglec-G/-10 functions as an inhibitory receptor is unknown.

Siglecg^-/- mice have increased levels of serum IgM and produce more IgM autoantibodies than wild-type mice (1;3). Over time, the Siglecg^-/- mice develop B-cell lymphoproliferative disorders, including diffuse large B-cell lymphoma, follicular lymphoma, medium-to-large B-cell monomorphic lymphoma and atypical lymphoproliferations (6). Older Siglecg^-/- mice also exhibited an autoimmune phenotype with increased autoantibody levels and mild glomerulonephritis as well as increased numbers of plasma cells, germinal center B cells, and activated CD4 T cells (7;8).

Siglecg^-/- mice exhibited increased numbers of B-1 (B-1a and B-1b) B cells due to reduced spontaneous apoptosis and increased life spans of the cells (1;3-5). The increased B1a cell frequency phenotype observed in the Chamonix mice indicates loss of Siglec-G-associated function.

Primers

PCR Primer
Chamonix_pcr_F: TTCAGGCTACAAGTGGAAGG
Chamonix_pcr_R: AGCATGGAGTTGGGGAATTC

Sequencing Primer
Chamonix_seq_F: GAACCTTGGTCTCTCACTGGG
Chamonix_seq_R: GAGTTGGGGAATTCTCTACCTCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 499 nucleotides is amplified (chromosome 7, + strand):

1   ttcaggctac aagtggaagg taagagttgt agacatagca gggaaccttg gtctctcact
61  gggggaggga cagtggaaga taaactgtga tgcaaagaag actacttctg ggaggagccg
121 ctggagtcac aggattggta tcctctccct tagccctgac tcagaagcca gatatcttca
181 ttcctgaggt cctggagcct ggggagccag tgaccgttgt ctgcttgttt tcctggacct
241 tcaaccaatg cccagctcct tctttctcct ggatggggga tgctgtctcc ttccaagaaa
301 gcagaccgca cacatccaat tactcagttc tgagctttat cccaggactt caacaccatg
361 atactgagct cacatgtcag ctggacttct ctagaatgag cacacaaagg actgtccgac
421 taagagtggc ctgtgagtat ggtatggtgc tttgggctgt cctggtggta ggaggtagag
481 aattccccaa ctccatgct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hoffmann, A., Kerr, S., Jellusova, J., Zhang, J., Weisel, F., Wellmann, U., Winkler, T. H., Kneitz, B., Crocker, P. R., and Nitschke, L. (2007) Siglec-G is a B1 Cell-Inhibitory Receptor that Controls Expansion and Calcium Signaling of the B1 Cell Population. Nat Immunol. 8, 695-704.

  2. Nitschke, L. (2009) CD22 and Siglec-G: B-Cell Inhibitory Receptors with Distinct Functions. Immunol Rev. 230, 128-143.

  3. Ding, C., Liu, Y., Wang, Y., Park, B. K., Wang, C. Y., Zheng, P., and Liu, Y. (2007) Siglecg Limits the Size of B1a B Cell Lineage by Down-Regulating NFkappaB Activation. PLoS One. 2, e997.

  4. Hutzler, S., Ozgor, L., Naito-Matsui, Y., Klasener, K., Winkler, T. H., Reth, M., and Nitschke, L. (2014) The Ligand-Binding Domain of Siglec-G is Crucial for its Selective Inhibitory Function on B1 Cells. J Immunol. 192, 5406-5414.

  5. Jellusova, J., Duber, S., Guckel, E., Binder, C. J., Weiss, S., Voll, R., and Nitschke, L. (2010) Siglec-G Regulates B1 Cell Survival and Selection. J Immunol. 185, 3277-3284.

  6. Simonetti, G., Bertilaccio, M. T., Rodriguez, T. V., Apollonio, B., Dagklis, A., Rocchi, M., Innocenzi, A., Casola, S., Winkler, T. H., Nitschke, L., Ponzoni, M., Caligaris-Cappio, F., and Ghia, P. (2014) SIGLEC-G Deficiency Increases Susceptibility to Develop B-Cell Lymphoproliferative Disorders. Haematologica. 99, 1356-1364.

  7. Muller, J., Lunz, B., Schwab, I., Acs, A., Nimmerjahn, F., Daniel, C., and Nitschke, L. (2015) Siglec-G Deficiency Leads to Autoimmunity in Aging C57BL/6 Mice. J Immunol. 195, 51-60.

  8. Bokers, S., Urbat, A., Daniel, C., Amann, K., Smith, K. G., Espeli, M., and Nitschke, L. (2014) Siglec-G Deficiency Leads to More Severe Collagen-Induced Arthritis and Earlier Onset of Lupus-Like Symptoms in MRL/lpr Mice. J Immunol. 192, 2994-3002.