Phenotypic Mutation 'sergeant' (pdf version)
Allelesergeant
Mutation Type missense
Chromosome2
Coordinate164,099,712 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Stk4
Gene Name serine/threonine kinase 4
Synonym(s) Ysk3, sterile 20-like kinase 1, Kas-2, Mst1
Chromosomal Location 164,070,322-164,155,524 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021420; MGI:1929004

Mapped Yes 
Amino Acid Change Serine changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000018353]
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209
AA Change: S283G

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
(Using ENSMUST00000018353)
SMART Domains Protein: ENSMUSP00000116745
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
Blast:S_TKc 2 26 8e-6 BLAST
PDB:3COM|B 2 26 4e-7 PDB
low complexity region 27 42 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score 0.0589 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - increased
FACS B:T cells - increased
FACS B1a cells in B1 cells - decreased
FACS B1b cells in B1 cells - increased
FACS B220 MFI - decreased
FACS CD11b+ DCs (gated in CD11c+ cells) - decreased
FACS CD11b+ DCs (gated in CD11c+ cells) - increased
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
FACS IgM+ B cells - increased
FACS macrophages - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK cells - increased
FACS T cells - decreased
Fasting Insulin (Female) - increased
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Total IgE After 2nd OVA/Alum Challenge (day 7) - increased
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.6696
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(55) : Chemically induced (ENU)(5) Gene trapped(37) Targeted(13)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
hallon UTSW 2 164099827 critical splice donor site probably null
iwo_jima UTSW 2 164088959 missense possibly damaging 0.94
ribeye UTSW 2 164079566 missense probably damaging 1.00
stryker UTSW 2 164083688 nonsense probably null
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1972:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3155:Stk4 UTSW 2 164151743 missense probably benign 0.01
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5088:Stk4 UTSW 2 164083688 nonsense probably null
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
R7453:Stk4 UTSW 2 164086602 missense probably benign 0.01
R7698:Stk4 UTSW 2 164083743 missense probably damaging 1.00
R7726:Stk4 UTSW 2 164110226 start codon destroyed probably null
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:30 PM by Anne Murray
Record Created 2019-01-23 9:33 AM by Bruce Beutler
Record Posted 2019-02-01
Phenotypic Description

Figure 1. Sergeant mice exhibit increased frequencies of peripheral B1b cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sergeant mice exhibit increased frequencies of CD8a+ dendritic cells (gated in CD11c+ cells). Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Sergeant mice exhibit reduced frequencies of CD11b+ dendritic cells (gated in CD11c+ cells). Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Sergeant mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Sergeant mice exhibit reduced IgD expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD mean fluorescence intensity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sergeant phenotype was identified among G3 mice of the pedigree R4288, some of which showed increased frequencies of B1b cells in B1 cells (Figure 1) and CD8a+ dendritic cells (gated in CD11c+ cells) (Figure 2) with concomitant reduced frequencies of CD11b+ dendritic cells (gated in CD11c+ cells) (Figure 3), all in the peripheral blood. The T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) was diminished (Figure 4). The mice also showed reduced IgD expression on peripheral blood B cells (Figure 5).

Nature of Mutation

Figure 6. Linkage mapping of the reduced CD11b+ DC frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 33 mutations (X-axis) identified in the G1 male of pedigree R4288. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 33 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in Stk4: an A to G transition at base pair 164,099,712 (v38) on chromosome 2, or base pair 25,600 in the GenBank genomic region NC_000068 encoding Stk4. The mutation in Stk4 was presumed causative as other alleles of Stk4 (see hallon and strkyer) exhibit similar immunological phenotypes as sergeant. The strongest association was found with a recessive model of inheritance to the normalized frequency of CD11b+ DCs, wherein three variant homozygotes departed phenotypically from nine homozygous reference mice and 20 heterozygous mice with a P value of 9.348 x 10-6  (Figure 6).  

 

The mutation corresponds to residue 922 in the mRNA sequence NM_021420 within exon 8 of 11 total exons.

  

907 CACCCGTTTGTTAAGAGTGCCAAAGGAGTGTCA

278 -H--P--F--V--K--S--A--K--G--V--S-

 

The mutated nucleotide is indicated in red. The mutation results in a serine to glycine substitution at position 283 (S283G) in the STK4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.939).

Protein Prediction

Figure 7. Domain organization of MST1. The sergeant mutation results in a serine to glycine substitution at position 283 (S283G). Other mutations found in the MST1 protein are shown in red. Click on each mutation for more information. Abbreviations: CC, coiled-coil; SARAH, Salvador/Rassf/Hippo domain.

Stk4 encodes mammalian sterile 20-like kinase 1 (MST1; alternatively, serine/threonine protein kinase 4 [STK4]), a member of the MST family of kinases that also includes MST2 (STK3), MST3 (STK24), MST4 (STK26), and YSK1 (STK25) [reviewed in (1)].

 

MST1 has two domains, an N-terminal kinase domain and a C-terminal SARAH (Salvador/Rassf/Hippo) domain (Figure 7). The SARAH domain is also involved in dimerization (2). In the Salvador and Hippo families, the SARAH domain mediates signal transduction from Hippo via the Salvador scaffolding protein to the downstream component Warts (SMART). The SARAH domain interacts with the SARAH domains of Rassf1 and Rassf5 (alternatively, Nore1), subsequently promoting apoptosis (2;3).

 

The sergeant mutation results in a serine to glycine substitution at position 283 (S283G); Ser283 is within an undefined region between the kinase domain and a coiled-oil.

 

Please see the record hallon for more information about Stk4.

Putative Mechanism

MST1 is a serine/threonine kinase with both proaopototic and antiapoptotic functions in several systems, including the immune system (4;5), cardiovascular system (6;7), digestive system (8;9), respiratory system (10), and the central nervous system [reviewed in (11)]. MST1 and MST2 are mammalian orthologs of Drosophila Hippo. Hippo is within a pathway that restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasisUpon Hippo pathway activation, the TAO kinases (TAOK1/2/3 see the record for taoist) phosphorylate Thr183 of MST1 (and Thr180 in MST2), resulting in MST1/2 activation (12). Thr183 can also be autophosphorylated. MST1/2 (in complex with the regulatory scaffold protein SAV1 [alternatively, WW45]) phosphorylate and activate large tumor suppressor 1/2 (LATS1/2). Activated LATS1/2 in complex with the regulatory protein MOB1 subsequently phosphorylates and inactivates the Yes-associated protein-1 (YAP1) oncoprotein (see the record for Puddel_hunde) and transcriptional coactivator with PDZ-binding motif (TAZ). When active, YAP1 and TAZ translocate to the nucleus to bind the TEAD transcription factor family (homologs of Drosophila Scalloped) and induce the expression of its target genes involved in cell proliferation, cell death, and cell migration.

 

Mutations in STK4 are linked to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations (OMIM: #614868) (13;14). Patients exhibited T- and B-cell lymphopenia, intermittent neutropenia, and atrial septal defects (14). Patients exhibited recurring bacterial infections, viral infections, skin abscesses, cutaneous warts, and mucocutaneous candidiasis.

 

MST1/2 phosphorylates members of the forkhead box O (FOXO) transcription factor family. The MST1-FOXO signaling pathway also maintains naïve T cell homeostasis and enhances Treg differentiation by promoting Foxp3’s acetylation and activity (15). Stk4-deficient (Stk4-/-) mice exhibit progressive loss of T and B cells due to excessive apoptosis (16;17). The Stk4-/- mice have reduced numbers of naïve T cells in secondary lymphoid organs and in the peripheral blood. Stk4-/- mice exhibited an accumulation of mature thymocytes in the thymus, a reduction of lymphocytes in blood and peripheral lymphoid tissues, and reduced ability to traffic to peripheral lymph nodes (4). Thymocytes from the Stk4-/- mice showed diminished chemotactic responses to CCL19, but not S1P (4). Mature T cells from the Stk4-/- mice exhibited a reduced capacity to egress from the thymus. Stk4-/- naïve T cells exhibited increased proliferation in response to TCR stimulation; the proliferative responses of Stk4-/- effector/memory T cells was comparable to that in wild-type (17). Stk4-/- mice exhibited inefficient migration and antigen recognition of CD4+ T cells within the medulla (18).

 

Mice that lack either Stk3 or Stk4 are viable, but mice that lack both Stk3 and Stk4 (Stk3-/-; Stk4-/-) are not (16). The Stk3-/-; Stk4-/- mice exhibited growth retardation, failed placental development, impaired yolk sac/embryo vascular patterning and primitive hematopoiesis, increased apoptosis in placentas and embryos, and disorganized proliferating cells in the embryo. A liver-specific double-knockout model exhibits hepatomegaly and hepatocellular carcinoma.

 

The phenotype observed in the sergeant mice indicate loss of MST1-associated function.

Primers PCR Primer
sergeant_pcr_F: TGTGCCCCAGGTTTGAAGAG
sergeant_pcr_R: TGTGGCAAGCGAGACCTAAG

Sequencing Primer
sergeant_seq_F: TTAAAGTAAATATTGTGGCCGGGC
sergeant_seq_R: GCAAGCGAGACCTAAGAAGTACAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 463 nucleotides is amplified (chromosome 2, + strand):


1   tgtgccccag gtttgaagag aaaaattaga cccactgatt tatatgacag atactgccag
61  gtttttatta cgtgccatgt actattttaa agtaaatatt gtggccgggc agtggtggca
121 gtggtggcct ttaatcccag cactcaggag gcaggtggat ctctacgttc aggaccagca
181 gagggagttc caggacagcc agggctacac agagaaaccc tgtgcccaga aaccaaagca
241 aaccgtgtcc attgttgtcc actttgttat ttaagcaccc gtttgttaag agtgccaaag
301 gagtgtcaat attgcgagac ttaattaacg aagccatgga tgtgaaactg aagcgccagg
361 aagcccagca gcgggaagtg gaccaggacg acgaggagaa ctcagtgagt ggctgctctc
421 tgctgggtca ggggtgtgta cttcttaggt ctcgcttgcc aca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler