Phenotypic Mutation 'iwo_jima'

• Allele: iwo_jima
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 163,930,879 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Stk4
• Gene Name: serine/threonine kinase 4
• Synonym(s): sterile 20-like kinase 1, Kas-2, Ysk3, Mst1
• Chromosomal Location: 163,916,033-163,997,444 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000018353] [ENSMUSP00000122440]
• AlphaFold: Q9JI11
• SMART Domains: Protein: ENSMUSP00000018353; Gene: ENSMUSG00000018209; AA Change: E160G

Domain	Start	End	E-Value	Type
S_TKc	30	281	1.97e-104	SMART
low complexity region	311	326	N/A	INTRINSIC
Pfam:Mst1_SARAH	433	480	2.4e-26	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000018353)
• SMART Domains: Protein: ENSMUSP00000122440; Gene: ENSMUSG00000018209

Domain	Start	End	E-Value	Type
Pfam:Pkinase	29	113	7.2e-22	PFAM
Pfam:Pkinase_Tyr	29	113	1.1e-17	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.7825
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Anne Murray
• Record Created: 2019-01-23 10:07 AM by Bruce Beutler
• Record Posted: 2019-02-01
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_021420; MGI:1929004

Alleles Listed at MGI

All Mutations and Alleles(55) : Chemically induced (ENU)(5) Gene trapped(37) Targeted(13)

Phenotypic Description

Figure 1. Iwo_jima mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Iwo_jima mice exhibit reduced frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Iwo_jima mice exhibit increased CD44 expression on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 mean fluorescence intensity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Iwo_jima mice exhibit increased CD44 expression on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 mean fluorescence intensity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The iwo_jima phenotype was identified among G3 mice of the pedigree R4360, some of which showed increased frequencies of central memory CD4 T cells in CD4 T cells (Figure 1) with concomitant reduced frequencies of naïve CD4 T cells in CD4 T cells (Figure 2). The mice also showed increased CD44 expression on peripheral blood T cells (Figure 3) and CD4+ T cells (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of the reduced naïve CD4+ T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R4360. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in Stk4: an A to G transition at base pair 164,088,959 (v38) on chromosome 2, or base pair 14,847 in the GenBank genomic region NC_000068 encoding Stk4.  The mutation in Stk4 was presumed causative as other alleles of Stk4 (see hallon and strkyer) exhibit similar immunological phenotypes as iwo_jima. The strongest association was found with a recessive model of inheritance to the normalized frequency of naïve CD4+ T cells, wherein seven variant homozygotes departed phenotypically from 12 homozygous reference mice and 17 heterozygous mice with a P value of 0.000217 (Figure 5).  

The mutation corresponds to residue 554 in the mRNA sequence NM_021420 within exon 5 of 11 total exons.

538 ATTTTGCTAAACACAGAAGGCCATGCAAAGCTT 155 -I--L--L--N--T--E--G--H--A--K--L-

The mutated nucleotide is indicated in red. The mutation results in a glutamic acid to glycine substitution at position 160 (E160G) in the STK4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.939).

Protein Prediction

Figure 6. Domain organization of MST1. The iwo_jima mutation results in a glutamic acid to glycine substitution at position 160. Other mutations found in the MST1 protein are shown in red. Click on each mutation for more information. Abbreviations: CC, coiled-coil; SARAH, Salvador/Rassf/Hippo domain.

Stk4 encodes mammalian sterile 20-like kinase 1 (MST1; alternatively, serine/threonine protein kinase 4 [STK4]), a member of the MST family of kinases that also includes MST2 (STK3), MST3 (STK24), MST4 (STK26), and YSK1 (STK25) [reviewed in (1)].

MST1 has two domains, an N-terminal kinase domain and a C-terminal SARAH (Salvador/Rassf/Hippo) domain (Figure 6). The SARAH domain is also involved in dimerization (2). In the Salvador and Hippo families, the SARAH domain mediates signal transduction from Hippo via the Salvador scaffolding protein to the downstream component Warts (SMART). The SARAH domain interacts with the SARAH domains of Rassf1 and Rassf5 (alternatively, Nore1), subsequently promoting apoptosis (2;3).

The iwo_jima mutation results in a glutamic acid to glycine substitution at position 160 (E160G); Glu160 is within the kinase domain.

Please see the record hallon for more information about Stk4.

Putative Mechanism

MST1 is a serine/threonine kinase with both proaopototic and antiapoptotic functions in several systems, including the immune system (4;5), cardiovascular system (6;7), digestive system (8;9), respiratory system (10), and the central nervous system [reviewed in (11)]. MST1 and MST2 are mammalian orthologs of Drosophila Hippo. Hippo is within a pathway that restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasis. Upon Hippo pathway activation, the TAO kinases (TAOK1/2/3 see the record for taoist) phosphorylate Thr183 of MST1 (and Thr180 in MST2), resulting in MST1/2 activation (12). Thr183 can also be autophosphorylated. MST1/2 (in complex with the regulatory scaffold protein SAV1 [alternatively, WW45]) phosphorylate and activate large tumor suppressor 1/2 (LATS1/2). Activated LATS1/2 in complex with the regulatory protein MOB1 subsequently phosphorylates and inactivates the Yes-associated protein-1 (YAP1) oncoprotein (see the record for Puddel_hunde) and transcriptional coactivator with PDZ-binding motif (TAZ). When active, YAP1 and TAZ translocate to the nucleus to bind the TEAD transcription factor family (homologs of Drosophila Scalloped) and induce the expression of its target genes involved in cell proliferation, cell death, and cell migration.

Mutations in STK4 are linked to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations (OMIM: #614868) (13;14). Patients exhibited T- and B-cell lymphopenia, intermittent neutropenia, and atrial septal defects (14). Patients exhibited recurring bacterial infections, viral infections, skin abscesses, cutaneous warts, and mucocutaneous candidiasis.

MST1/2 phosphorylates members of the forkhead box O (FOXO) transcription factor family. The MST1-FOXO signaling pathway also maintains naïve T cell homeostasis and enhances Treg differentiation by promoting Foxp3’s acetylation and activity (15). Stk4-deficient (Stk4^-/-) mice exhibit progressive loss of T and B cells due to excessive apoptosis (16;17). The Stk4^-/- mice have reduced numbers of naïve T cells in secondary lymphoid organs and in the peripheral blood. Stk4^-/- mice exhibited an accumulation of mature thymocytes in the thymus, a reduction of lymphocytes in blood and peripheral lymphoid tissues, and reduced ability to traffic to peripheral lymph nodes (4). Thymocytes from the Stk4^-/- mice showed diminished chemotactic responses to CCL19, but not S1P (4). Mature T cells from the Stk4^-/- mice exhibited a reduced capacity to egress from the thymus. Stk4^-/- naïve T cells exhibited increased proliferation in response to TCR stimulation; the proliferative responses of Stk4^-/- effector/memory T cells was comparable to that in wild-type (17). Stk4^-/- mice exhibited inefficient migration and antigen recognition of CD4+ T cells within the medulla (18).

Mice that lack either Stk3 or Stk4 are viable, but mice that lack both Stk3 and Stk4 (Stk3^-/-; Stk4^-/-) are not (16). The Stk3^-/-; Stk4^-/- mice exhibited growth retardation, failed placental development, impaired yolk sac/embryo vascular patterning and primitive hematopoiesis, increased apoptosis in placentas and embryos, and disorganized proliferating cells in the embryo. A liver-specific double-knockout model exhibits hepatomegaly and hepatocellular carcinoma.

The phenotype observed in the iwo_jima mice indicate loss of MST1-associated function.

Primers

PCR Primer
iwo_jima_pcr_F: TGAAGCAGCTGTGTGTCAC
iwo_jima_pcr_R: TGAGTCAACAGGCATGCATG

Sequencing Primer
iwo_jima_seq_F: TCACGGAGTTTGGATGTAGC
iwo_jima_seq_R: TGCATGCGCACACACACG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 2, + strand):

1   tgaagcagct gtgtgtcacg gagtttggat gtagcttttc tcttttctcc tatttgatgt
61  taacaggctt gagacatctt actgtttttt gtttttcagt taacagaaga tgaaatagct
121 acaatattac aatcaactct taagggacta gaataccttc attttatgag aaaaatacac
181 cgagatatca aggcgggaaa tattttgcta aacacagaag gccatgcaaa gcttgcagac
241 tttggagtcg caggtcaact tacagtaagt ggaagtggtg actggtacca gtactgtagg
301 ctgtgtcttg agaagccaat tccaataagt gactttatgt gtgtgtgtgt gtgtgcgtgt
361 gtgtgcgtgt gtgtgcgcat gcatgcatgc ctgttgactc a

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Thompson, B. J., and Sahai, E. (2015) MST Kinases in Development and Disease. J Cell Biol. 210, 871-882.

  2. Hwang, E., Ryu, K. S., Paakkonen, K., Guntert, P., Cheong, H. K., Lim, D. S., Lee, J. O., Jeon, Y. H., and Cheong, C. (2007) Structural Insight into Dimeric Interaction of the SARAH Domains from Mst1 and RASSF Family Proteins in the Apoptosis Pathway. Proc Natl Acad Sci U S A. 104, 9236-9241.

  3. Scheel, H., and Hofmann, K. (2003) A Novel Interaction Motif, SARAH, Connects Three Classes of Tumor Suppressor. Curr Biol. 13, R899-900.

  4. Dong, Y., Du, X., Ye, J., Han, M., Xu, T., Zhuang, Y., and Tao, W. (2009) A Cell-Intrinsic Role for Mst1 in Regulating Thymocyte Egress. J Immunol. 183, 3865-3872.

  5. Mou, F., Praskova, M., Xia, F., Van Buren, D., Hock, H., Avruch, J., and Zhou, D. (2012) The Mst1 and Mst2 Kinases Control Activation of Rho Family GTPases and Thymic Egress of Mature Thymocytes. J Exp Med. 209, 741-759.

  6. von Gise, A., Lin, Z., Schlegelmilch, K., Honor, L. B., Pan, G. M., Buck, J. N., Ma, Q., Ishiwata, T., Zhou, B., Camargo, F. D., and Pu, W. T. (2012) YAP1, the Nuclear Target of Hippo Signaling, Stimulates Heart Growth through Cardiomyocyte Proliferation but Not Hypertrophy. Proc Natl Acad Sci U S A. 109, 2394-2399.

  7. Yamamoto, S., Yang, G., Zablocki, D., Liu, J., Hong, C., Kim, S. J., Soler, S., Odashima, M., Thaisz, J., Yehia, G., Molina, C. A., Yatani, A., Vatner, D. E., Vatner, S. F., and Sadoshima, J. (2003) Activation of Mst1 Causes Dilated Cardiomyopathy by Stimulating Apoptosis without Compensatory Ventricular Myocyte Hypertrophy. J Clin Invest. 111, 1463-1474.

  8. Lu, L., Li, Y., Kim, S. M., Bossuyt, W., Liu, P., Qiu, Q., Wang, Y., Halder, G., Finegold, M. J., Lee, J. S., and Johnson, R. L. (2010) Hippo Signaling is a Potent in Vivo Growth and Tumor Suppressor Pathway in the Mammalian Liver. Proc Natl Acad Sci U S A. 107, 1437-1442.

  9. Zhou, D., Zhang, Y., Wu, H., Barry, E., Yin, Y., Lawrence, E., Dawson, D., Willis, J. E., Markowitz, S. D., Camargo, F. D., and Avruch, J. (2011) Mst1 and Mst2 Protein Kinases Restrain Intestinal Stem Cell Proliferation and Colonic Tumorigenesis by Inhibition of Yes-Associated Protein (Yap) Overabundance. Proc Natl Acad Sci U S A. 108, E1312-20.

  10. Chung, C., Kim, T., Kim, M., Kim, M., Song, H., Kim, T. S., Seo, E., Lee, S. H., Kim, H., Kim, S. K., Yoo, G., Lee, D. H., Hwang, D. S., Kinashi, T., Kim, J. M., and Lim, D. S. (2013) Hippo-Foxa2 Signaling Pathway Plays a Role in Peripheral Lung Maturation and Surfactant Homeostasis. Proc Natl Acad Sci U S A. 110, 7732-7737.

  11. Chen, S., Fang, Y., Xu, S., Reis, C., and Zhang, J. (2018) Mammalian Sterile20-Like Kinases: Signalings and Roles in Central Nervous System. Aging Dis. 9, 537-552.

  12. Boggiano, J. C., Vanderzalm, P. J., and Fehon, R. G. (2011) Tao-1 Phosphorylates Hippo/MST Kinases to Regulate the Hippo-Salvador-Warts Tumor Suppressor Pathway. Dev Cell. 21, 888-895.

  13. Nehme, N. T., Pachlopnik Schmid, J., Debeurme, F., Andre-Schmutz, I., Lim, A., Nitschke, P., Rieux-Laucat, F., Lutz, P., Picard, C., Mahlaoui, N., Fischer, A., and de Saint Basile, G. (2012) MST1 Mutations in Autosomal Recessive Primary Immunodeficiency Characterized by Defective Naive T-Cell Survival. Blood. 119, 3458-3468.

  14. Abdollahpour, H., Appaswamy, G., Kotlarz, D., Diestelhorst, J., Beier, R., Schaffer, A. A., Gertz, E. M., Schambach, A., Kreipe, H. H., Pfeifer, D., Engelhardt, K. R., Rezaei, N., Grimbacher, B., Lohrmann, S., Sherkat, R., and Klein, C. (2012) The Phenotype of Human STK4 Deficiency. Blood. 119, 3450-3457.

  15. Choi, J., Oh, S., Lee, D., Oh, H. J., Park, J. Y., Lee, S. B., and Lim, D. S. (2009) Mst1-FoxO Signaling Protects Naive T Lymphocytes from Cellular Oxidative Stress in Mice. PLoS One. 4, e8011.

  16. Oh, S., Lee, D., Kim, T., Kim, T. S., Oh, H. J., Hwang, C. Y., Kong, Y. Y., Kwon, K. S., and Lim, D. S. (2009) Crucial Role for Mst1 and Mst2 Kinases in Early Embryonic Development of the Mouse. Mol Cell Biol. 29, 6309-6320.

  17. Zhou, D., Medoff, B. D., Chen, L., Li, L., Zhang, X. F., Praskova, M., Liu, M., Landry, A., Blumberg, R. S., Boussiotis, V. A., Xavier, R., and Avruch, J. (2008) The Nore1B/Mst1 Complex Restrains Antigen Receptor-Induced Proliferation of Naive T Cells. Proc Natl Acad Sci U S A. 105, 20321-20326.

  18. Ueda, Y., Katagiri, K., Tomiyama, T., Yasuda, K., Habiro, K., Katakai, T., Ikehara, S., Matsumoto, M., and Kinashi, T. (2012) Mst1 Regulates Integrin-Dependent Thymocyte Trafficking and Antigen Recognition in the Thymus. Nat Commun. 3, 1098.