Phenotypic Mutation 'split_pea'

• Allele: split_pea
• Mutation Type: nonsense
• Chromosome: 2
• Coordinate: 121,059,087 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Trp53bp1
• Gene Name: transformation related protein 53 binding protein 1
• Synonym(s): 53BP1, p53BP1
• Chromosomal Location: 121,023,762-121,101,888 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000106277] [ENSMUSP00000106278] [ENSMUSP00000114457]
• AlphaFold: P70399
• SMART Domains: Protein: ENSMUSP00000106277; Gene: ENSMUSG00000043909; AA Change: R925*

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1430	1551	2.5e-80	PFAM
low complexity region	1581	1601	N/A	INTRINSIC
BRCT	1673	1785	7.13e-1	SMART
BRCT	1813	1901	1.03e-6	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000106278; Gene: ENSMUSG00000043909; AA Change: R925*

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1480	1601	1.5e-80	PFAM
low complexity region	1631	1651	N/A	INTRINSIC
BRCT	1723	1835	7.13e-1	SMART
BRCT	1863	1951	1.03e-6	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000114457; Gene: ENSMUSG00000043909

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC

• Predicted Effect: probably benign
• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Diantha La Vine
• Record Created: 2019-01-23 10:32 AM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013735, NM_001290830; MGI:1351320

Alleles Listed at MGI

All Mutations and Alleles(36) : Chemically induced (ENU)(5) Chemically induced (other)(1) Gene trapped(26) Radiation induced(1) Targeted(3)

Phenotypic Description

Figure 1. Split_pea mice exhibit reduced IgD mean fluorescence intensity (MFI). Flow cytometric analysis of peripheral blood was utilized to determine the IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The split_pea phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4755, some of which showed reduced IgD expression on B cells compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of reduced IgD MFI using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted againts the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R4755. Normalized phenotypic data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction , respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. The IgD phenotype was linked by continuous variable mapping to a mutation in Trp53bp1: an A to T transversion at base pair 121,228,606 (v38) on chromosome 2, or base pair 61,720 in the GenBank genomic region NC_000068 encoding Trp53bp1. Linkage was found with a recessive model of inheritance, wherein one variant homozygote departed phenotypically from six homozygous reference mice and 11 heterozygous mice with a P value of 5.707 x 10^-5 (Figure 2). The mutation in Trp53bp1 was presumed causative as the phenotype of the split_pea mice mimics that of other Trp53bp1 alleles (see lentil).

The mutation corresponds to residue 2,902 in the mRNA sequence NM_013735 within exon 13 of 28 total exons.

2887 AAATTGGAGCCCAAGAGACATAGTACTCCTATT 920  -K--L--E--P--K--R--H--S--T--P--I-

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 925 for a stop codon (R925*) in the 53BP1 protein.

Protein Prediction

Figure 3. Domain structure of 53BP1. The split_pea mutation (R925*) is indicated in red. This image is interactive. Click on each allele for more information. See the text for more details on the domains of 53BP1. Click on the other mutations to view more information about those alleles. Abbreviations: KBD, kinetochore-binding domain; OLIGO, oligomerization domain; GAR, glycine/arginine-rich region; UDR, ubiquitin-dependent recruitment motif; NLS, nuclear localization signal; BRCT, BRCA1 C-terminus. The phosphoinositide 3-kinase-like kinase (PIKK) S/TQ phosphorylation sites are labeled (Ser6, Ser25, Ser29, Ser166, Ser176/Ser178, Thr302, Ser452, Ser831, and Ser1219) as well as the site of ubiquitination (Lys1523).

Trp53bp1 (transformation related protein 53 binding protein 1) encodes 53BP1. 53BP1 has two tandem Tudor domains at amino acids 1475-1575 (1) (alternatively, amino acids 1469-1574 (2) or amino acids 1480-1601, SMART) [Figure 3; (3;4)]. Amino acids 1220-1601 of 53BP1 comprise a kinetochore-binding domain (KBD) (1;5). A nuclear localization signal (NLS; amino acids 1645-1703) and the KBD are sufficient to target 53BP1 to IR-induced foci (IRIF) (2). Within the KBD, amino acids 1231–1270 are required for homo-oligomerization (6). 53BP1 has two tandem breast cancer 1 early-onset (BRCA1) C-terminus (BRCT) domains at amino acids 1708-1969 (alternatively, amino acids 1723-1951, SMART) (7). 53BP1 has a highly conserved glycine/arginine-rich region (GAR; RGRGRRGR; amino acids 1380-1386) (1;2).

The split_pea mutation results in substitution of arginine 925 for a stop codon (R925*). Residue 925 is in an undefined region preceding the KBD.

For more information about Trp53bp1, please see the record for lentil and (8).

Putative Mechanism

53BP1 has several functions including facilitating DNA damage signaling, telomere fusions, NHEJ of DNA double strand break (DSBs) in CSR, transducing ATM-dependent cell cycle checkpoints (intra-S and G2/M), accumulation of p53, phosphorylation of several ATM substrates (e.g., Chk2 and BRCA1) in response to IR, and tumor suppression (9-16).

Dysregulation of TRP53BP1 expression is associated with several human conditions. TRP53BP1 expression in BRCA1-associated breast cancers (17;18), lymphomas, and solid tumors is reduced (17;19-21). Low levels of TRP53BP1 are correlated with an aggressive form of the disease, correlating with increased metastases and decreased survival [reviewed in (22)]. 53BP1 deficiency and the deregulation of AID, leads to increased DSB formation, resulting in B cell lymphoma (23). Patients with RIDDLE syndrome (OMIM: #611943) lack the ability to recruit 53BP1 to the sites of DNA DSBs (24).

MEFs from both Trp53bp1^-/- and m53BP1^tr/tr embryos exhibited reduced proliferation compared to controls (25). Both models are viable, but exhibit growth retardation and increased cellular sensitivity to IR (25;26). The m53BP1^tr/tr mice were fertile, but produced smaller litters than wild-type animals (26). After IR, Trp53bp1^-/- cells arrested in G2 and exhibited a delayed exit from the G2/M phase; the percentage of mitotic cells 24 hours after IR was lower than wild-type cells (25). The Trp53bp1 mouse models exhibit immune deficiencies including defects in T cell maturation (25;26). The levels of CD4 T cells, γ–δ T cells, and B cells were all reduced in the Trp53bp1^-/- mice with a concomitant increase in the percentage of CD4^-CD8^- progenitors and apoptosis (25;27). In addition, the Trp53bp1^-/- thymocytes exhibited an increased number of aberrant cells (either lost Cα (2 TCRVα, 1 TCRCα signal) or both Vα and Cα from one allele (1 TCRVα, 1 TCRCα)) (27). Bone marrow pro-B, pre-B, myeloid, and erthyroid progenitor populations were normal in the m53BP1^tr/tr mice (16;26). However, the spleens from the m53BP1^tr/tr mice were deficient in mature B cells (IgM^loIgD^hi) (26). IgM levels in the Trp53bp1^-/- mice were similar to those in wild-type mice, indicating that B cell activation to mediate IgM secretion is not affected upon loss of 53BP1, however, the levels of all IgG subclasses and IgA were decreased (16). CD4 and CD8 T cell populations were similar between m53BP1^tr/tr and wild-type mice, but the progression out of the DNIII stage in development, when β-gene rearrangement occurs, was impaired in the m53BP1^tr/tr mice (26). Thymus size in the m53BP1^tr/tr mice was smaller and had fewer cells than wild-type mice; the lymphoid organ architecture was normal (26). The phenotype exhibited by the split_pea mice indicates loss of 53BP1-associated function.

Primers

PCR Primer
split_pea_pcr_F: AGTGAGGTCAAACCCTGCTG
split_pea_pcr_R: GGCTGTGAAGCTGATAGGAC

Sequencing Primer
split_pea_seq_F: GTCAAACCCTGCTGCTCCAC
split_pea_seq_R: GAAGGTGATATTATCCCACCA

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 431 nucleotides is amplified (chromosome 2, - strand):

1   ggctgtgaag ctgataggac taagaaactg ggaaaggagc aactggaatt tttttttttt
61  gtagtttctc atttttgtgt aatgtacact tctatgtggt ttgtgttttt ttcaattgtg
121 ttttcatttt tgtttgtttg tttatttcag aaactccatt tcatttcact ttgcctaaag
181 aaggtgatat tatcccacca ttgactggcg caaccccacc tcttattggg cacctaaaat
241 tggagcccaa gagacatagt actcctattg gtgagtgatt aaaaacaaag atatttaagg
301 cattaaaata aaagctacct aaagcccttc taagatacca ttcttcatgc aagtggaact
361 tttctgtctg aggagttggc ctgactgaga gggctgatgt ttggtgtgga gcagcagggt
421 ttgacctcac t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Charier, G., Couprie, J., Alpha-Bazin, B., Meyer, V., Quemeneur, E., Guerois, R., Callebaut, I., Gilquin, B., and Zinn-Justin, S. (2004) The Tudor Tandem of 53BP1: A New Structural Motif Involved in DNA and RG-Rich Peptide Binding. Structure. 12, 1551-1562.

  2. Pryde, F., Khalili, S., Robertson, K., Selfridge, J., Ritchie, A. M., Melton, D. W., Jullien, D., and Adachi, Y. (2005) 53BP1 Exchanges Slowly at the Sites of DNA Damage and Appears to Require RNA for its Association with Chromatin. J Cell Sci. 118, 2043-2055.

  3. Iwabuchi, K., Basu, B. P., Kysela, B., Kurihara, T., Shibata, M., Guan, D., Cao, Y., Hamada, T., Imamura, K., Jeggo, P. A., Date, T., and Doherty, A. J. (2003) Potential Role for 53BP1 in DNA End-Joining Repair through Direct Interaction with DNA. J Biol Chem. 278, 36487-36495.

  4. Huyen, Y., Zgheib, O., Ditullio, R. A.,Jr, Gorgoulis, V. G., Zacharatos, P., Petty, T. J., Sheston, E. A., Mellert, H. S., Stavridi, E. S., and Halazonetis, T. D. (2004) Methylated Lysine 79 of Histone H3 Targets 53BP1 to DNA Double-Strand Breaks. Nature. 432, 406-411.

  5. Jullien, D., Vagnarelli, P., Earnshaw, W. C., and Adachi, Y. (2002) Kinetochore Localisation of the DNA Damage Response Component 53BP1 during Mitosis. J Cell Sci. 115, 71-79.

  6. Zgheib, O., Pataky, K., Brugger, J., and Halazonetis, T. D. (2009) An Oligomerized 53BP1 Tudor Domain Suffices for Recognition of DNA Double-Strand Breaks. Mol Cell Biol. 29, 1050-1058.

  7. Bothmer, A., Robbiani, D. F., Di Virgilio, M., Bunting, S. F., Klein, I. A., Feldhahn, N., Barlow, J., Chen, H. T., Bosque, D., Callen, E., Nussenzweig, A., and Nussenzweig, M. C. (2011) Regulation of DNA End Joining, Resection, and Immunoglobulin Class Switch Recombination by 53BP1. Mol Cell. 42, 319-329.

  8. Choi, J. H., Wang, K. W., Zhang, D., Zhan, X., Wang, T., Bu, C. H., Behrendt, C. L., Zeng, M., Wang, Y., Misawa, T., Li, X., Tang, M., Zhan, X., Scott, L., Hildebrand, S., Murray, A. R., Moresco, E. M., Hooper, L. V., and Beutler, B. (2017) IgD Class Switching is Initiated by Microbiota and Limited to Mucosa-Associated Lymphoid Tissue in Mice. Proc Natl Acad Sci U S A. 114, E1196-E1204.

  9. Liu, X., Jiang, W., Dubois, R. L., Yamamoto, K., Wolner, Z., and Zha, S. (2012) Overlapping Functions between XLF Repair Protein and 53BP1 DNA Damage Response Factor in End Joining and Lymphocyte Development. Proc Natl Acad Sci U S A. 109, 3903-3908.

  10. Lee, H., Kwak, H. J., Cho, I. T., Park, S. H., and Lee, C. H. (2009) S1219 Residue of 53BP1 is Phosphorylated by ATM Kinase upon DNA Damage and Required for Proper Execution of DNA Damage Response. Biochem Biophys Res Commun. 378, 32-36.

  11. Wang, B., Matsuoka, S., Carpenter, P. B., and Elledge, S. J. (2002) 53BP1, a Mediator of the DNA Damage Checkpoint. Science. 298, 1435-1438.

  12. Ward, I. M., Reina-San-Martin, B., Olaru, A., Minn, K., Tamada, K., Lau, J. S., Cascalho, M., Chen, L., Nussenzweig, A., Livak, F., Nussenzweig, M. C., and Chen, J. (2004) 53BP1 is Required for Class Switch Recombination. J Cell Biol. 165, 459-464.

  13. Dimitrova, N., Chen, Y. C., Spector, D. L., and de Lange, T. (2008) 53BP1 Promotes Non-Homologous End Joining of Telomeres by Increasing Chromatin Mobility. Nature. 456, 524-528.

  14. DiTullio, R. A.,Jr, Mochan, T. A., Venere, M., Bartkova, J., Sehested, M., Bartek, J., and Halazonetis, T. D. (2002) 53BP1 Functions in an ATM-Dependent Checkpoint Pathway that is Constitutively Activated in Human Cancer. Nat Cell Biol. 4, 998-1002.

  15. Fernandez-Capetillo, O., Chen, H. T., Celeste, A., Ward, I., Romanienko, P. J., Morales, J. C., Naka, K., Xia, Z., Camerini-Otero, R. D., Motoyama, N., Carpenter, P. B., Bonner, W. M., Chen, J., and Nussenzweig, A. (2002) DNA Damage-Induced G2-M Checkpoint Activation by Histone H2AX and 53BP1. Nat Cell Biol. 4, 993-997.

  16. Manis, J. P., Morales, J. C., Xia, Z., Kutok, J. L., Alt, F. W., and Carpenter, P. B. (2004) 53BP1 Links DNA Damage-Response Pathways to Immunoglobulin Heavy Chain Class-Switch Recombination. Nat Immunol. 5, 481-487.

  17. Bouwman, P., Aly, A., Escandell, J. M., Pieterse, M., Bartkova, J., van der Gulden, H., Hiddingh, S., Thanasoula, M., Kulkarni, A., Yang, Q., Haffty, B. G., Tommiska, J., Blomqvist, C., Drapkin, R., Adams, D. J., Nevanlinna, H., Bartek, J., Tarsounas, M., Ganesan, S., and Jonkers, J. (2010) 53BP1 Loss Rescues BRCA1 Deficiency and is Associated with Triple-Negative and BRCA-Mutated Breast Cancers. Nat Struct Mol Biol. 17, 688-695.

  18. Bunting, S. F., Callen, E., Wong, N., Chen, H. T., Polato, F., Gunn, A., Bothmer, A., Feldhahn, N., Fernandez-Capetillo, O., Cao, L., Xu, X., Deng, C. X., Finkel, T., Nussenzweig, M., Stark, J. M., and Nussenzweig, A. (2010) 53BP1 Inhibits Homologous Recombination in Brca1-Deficient Cells by Blocking Resection of DNA Breaks. Cell. 141, 243-254.

  19. Li, X., Xu, B., Moran, M. S., Zhao, Y., Su, P., Haffty, B. G., Shao, C., and Yang, Q. (2012) 53BP1 Functions as a Tumor Suppressor in Breast Cancer Via the Inhibition of NF-kappaB through miR-146a. Carcinogenesis. 33, 2593-2600.

  20. Neboori, H. J., Haffty, B. G., Wu, H., Yang, Q., Aly, A., Goyal, S., Schiff, D., Moran, M. S., Golhar, R., Chen, C., Moore, D., and Ganesan, S. (2012) Low p53 Binding Protein 1 (53BP1) Expression is Associated with Increased Local Recurrence in Breast Cancer Patients Treated with Breast-Conserving Surgery and Radiotherapy. Int J Radiat Oncol Biol Phys. 83, e677-83.

  21. Takeyama, K., Monti, S., Manis, J. P., Dal Cin, P., Getz, G., Beroukhim, R., Dutt, S., Aster, J. C., Alt, F. W., Golub, T. R., and Shipp, M. A. (2008) Integrative Analysis Reveals 53BP1 Copy Loss and Decreased Expression in a Subset of Human Diffuse Large B-Cell Lymphomas. Oncogene. 27, 318-322.

  22. Lowndes, N. F. (2010) The Interplay between BRCA1 and 53BP1 Influences Death, Aging, Senescence and Cancer. DNA Repair (Amst). 9, 1112-1116.

  23. Jankovic, M., Feldhahn, N., Oliveira, T. Y., Silva, I. T., Kieffer-Kwon, K. R., Yamane, A., Resch, W., Klein, I., Robbiani, D. F., Casellas, R., and Nussenzweig, M. C. (2013) 53BP1 Alters the Landscape of DNA Rearrangements and Suppresses AID-Induced B Cell Lymphoma. Mol Cell. 49, 623-631.

  24. Stewart, G. S., Stankovic, T., Byrd, P. J., Wechsler, T., Miller, E. S., Huissoon, A., Drayson, M. T., West, S. C., Elledge, S. J., and Taylor, A. M. (2007) RIDDLE Immunodeficiency Syndrome is Linked to Defects in 53BP1-Mediated DNA Damage Signaling. Proc Natl Acad Sci U S A. 104, 16910-16915.

  25. Ward, I. M., Minn, K., van Deursen, J., and Chen, J. (2003) P53 Binding Protein 53BP1 is Required for DNA Damage Responses and Tumor Suppression in Mice. Mol Cell Biol. 23, 2556-2563.

  26. Morales, J. C., Xia, Z., Lu, T., Aldrich, M. B., Wang, B., Rosales, C., Kellems, R. E., Hittelman, W. N., Elledge, S. J., and Carpenter, P. B. (2003) Role for the BRCA1 C-Terminal Repeats (BRCT) Protein 53BP1 in Maintaining Genomic Stability. J Biol Chem. 278, 14971-14977.

  27. Difilippantonio, S., Gapud, E., Wong, N., Huang, C. Y., Mahowald, G., Chen, H. T., Kruhlak, M. J., Callen, E., Livak, F., Nussenzweig, M. C., Sleckman, B. P., and Nussenzweig, A. (2008) 53BP1 Facilitates Long-Range DNA End-Joining during V(D)J Recombination. Nature. 456, 529-533.