Phenotypic Mutation 'lobet'

• Allele: lobet
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 5,779,491 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Polm
• Gene Name: polymerase (DNA directed), mu
• Synonym(s): Tdt-N, B230309I03Rik
• Chromosomal Location: 5,777,860-5,788,016 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for disruptions in this gene display an apparently normal phenotype. However, B cell maturation and proliferation is abnormal. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tryptophan changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020767] [ENSMUSP00000105463]
• AlphaFold: Q9JIW4
• PDB Structure: Polymerase mu in ternary complex with gapped 11mer DNA duplex and bound incoming nucleotide [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000020767; Gene: ENSMUSG00000020474; AA Change: W436R

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
PDB:2HTF|A	27	124	2e-42	PDB
POLXc	150	495	1.78e-115	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000020767)
• SMART Domains: Protein: ENSMUSP00000105463; Gene: ENSMUSG00000020474; AA Change: W436R

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
Blast:BRCT	27	112	1e-45	BLAST
PDB:2HTF|A	27	124	4e-42	PDB
POLXc	150	500	8.68e-78	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000109837)
• Meta Mutation Damage Score: 0.9734
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:29 PM by Anne Murray
• Record Created: 2019-01-26 1:45 PM by Bruce Beutler
• Record Posted: 2019-03-13
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_017401; MGI:1860191

Alleles Listed at MGI

All Mutations and Alleles(5) : Targeted(5)

Phenotypic Description

Figure 1. Lobet mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lobet mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The lobet phenotype was identified among G3 mice of the pedigree R6401, some of which showed reduced B to T cell ratios (Figure 1) due to reduced B cell frequencies of in the peripheral blood (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced B cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 42 mutations (X-axis) identified in the G1 male of pedigree R6401. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 42 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Polm: a T to A transversion at base pair 5,829,491 (v38) on chromosome 11, or base pair 8,852 in the GenBank genomic region NC_000077. The strongest association was found with a recessive model of inheritance to the B cell phenotype, wherein seven variant homozygotes departed phenotypically from 25 homozygous reference mice and 39 heterozygous mice with a P value of 6.839 x 10^-7 (Figure 3). 

The mutation corresponds to residue 1,571 in the mRNA sequence NM_017401 within exon 9 of 11 total exons.

1556 TTTGCCCTTCTGGGCTGGACTGGCTCCCAGTTC 431  -F--A--L--L--G--W--T--G--S--Q--F-

The mutated nucleotide is indicated in red. The mutation results in a tryptophan to arginine substitution at position 436 (W436R) in the Polμ protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 4. Domain organization of Polμ. The lobet mutation results in a tryptophan to arginine substitution at position 436. This image is interactive. Other mutations found in Polm are noted in red. Click on each allele for more information. Abbreviations: NLS, nuclear localization sequence; BRCT, BRCA-1 C-terminal; NTE, N-terminal extension; HHH, helix-hairpin-helix motif

Polm encodes polμ, a member of the polX family of DNA polymerases that also includes terminal deoxyribonucleotidyl transferase (TdT) and polb. Polμ has a nuclear localization sequence, a BRCA-1 C-terminal (BRCT) domain, and a conserved polβ core (amino acids 141 to 494) containing an 8-kDa N-terminal extension, two helix-hairpin-helix (HHH) DNA-binding motifs, and a polX domain (1;2).

The lobet mutation results in a tryptophan to arginine substitution at position 436 (W436R). Amino acid 436 is within the thumb structure of the polymerase domain.

Please see the record gott for more information about Polm.

Putative Mechanism

V(D)J recombination affects the variable domain of immunoglobulin and T cell receptor (TCR) genes during lymphoid cell development. Polμ is a DNA polymerase that processes DNA ends during immunoglobulin kappa light chain rearrangements in V(D)J recombination in lymphocytes (3-5). In non-lymphocyte cells, Polμ functions in template-dependent DNA double-strand break repair via non-homologous end-joining (NHEJ) (5-8). Polμ can fill short gaps in a template-dependent manner (6) and is also able to catalyze template-independent synthesis (2). Polμ is able to incorporate ribonucleotide triphosphates almost as efficiently as deoxyribonucleotides (5). There is a partial substrate overlap by polµ and polλ, but there is a preference for polλ over polµ in repairing the majority of complementary double-strand breaks (9). However, polµ is the only known polymerase that can use noncomplementary substrates (9).

Polm-deficient (Polm^-/-) mice showed abnormal immunoglobulin light chain V-J recombination (3;4), slowed maturation of B cells (from IgM^- to IgM⁺) (3), reduced B cell number in the spleen and Peyer’s patches (3;10), underdeveloped B cell compartments in Peyer’s patches (3), absent separation of T and B cells in Peyer’s patches (3), lymphoid hypoplasia (3), and increased numbers of centroblasts compared to wild-type mice after immunization with a chicken gammaglobulin conjugate (11). The phenotypes observed in the lobet mice indicate loss of Polμ-associated function.

Primers

PCR Primer
lobet_pcr_F: AGGATCAAACAGCCCATGG
lobet_pcr_R: CTGTATCACCAGTACCACCG

Sequencing Primer
lobet_seq_F: GCTTCCTTTAGCAGGGTT
lobet_seq_R: GTACCACCGCAGCCATTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 11, - strand):

1   ctgtatcacc agtaccaccg cagccatttg gcagactcag cccacaacct gcggcagcgg
61  agctccacca tggatgcttt tgagaggagt ttctgcatct tgggtttgcc acaaccccaa
121 caggcagctt tagcgggggc cctgcctccc tgcccaactt ggaaagctgt gagggtagat
181 cttgtggtca cgcccagcag ccagttcccc tttgcccttc tgggctggac tggctcccag
241 gtaagtcatg tgttcctttc cgggccggga ctgtggtggg ccaaccctgc taaaggaagc
301 tgtcccttcc ctctctcctc agttctttga gcgggagcta cggcggttca gccgtcaaga
361 gaaggggctg tggcttaaca gccatgggct gtttgatcct 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Aoufouchi, S., Flatter, E., Dahan, A., Faili, A., Bertocci, B., Storck, S., Delbos, F., Cocea, L., Gupta, N., Weill, J. C., and Reynaud, C. A. (2000) Two Novel Human and Mouse DNA Polymerases of the polX Family. Nucleic Acids Res. 28, 3684-3693.

  2. Dominguez, O., Ruiz, J. F., Lain de Lera, T., Garcia-Diaz, M., Gonzalez, M. A., Kirchhoff, T., Martinez-A, C., Bernad, A., and Blanco, L. (2000) DNA Polymerase Mu (Pol Mu), Homologous to TdT, could Act as a DNA Mutator in Eukaryotic Cells. EMBO J. 19, 1731-1742.

  3. Bertocci, B., De Smet, A., Berek, C., Weill, J. C., and Reynaud, C. A. (2003) Immunoglobulin Kappa Light Chain Gene Rearrangement is Impaired in Mice Deficient for DNA Polymerase Mu. Immunity. 19, 203-211.

  4. Bertocci, B., De Smet, A., Weill, J. C., and Reynaud, C. A. (2006) Nonoverlapping Functions of DNA Polymerases Mu, Lambda, and Terminal Deoxynucleotidyltransferase during Immunoglobulin V(D)J Recombination in Vivo. Immunity. 25, 31-41.

  5. Nick McElhinny, S. A., and Ramsden, D. A. (2003) Polymerase Mu is a DNA-Directed DNA/RNA Polymerase. Mol Cell Biol. 23, 2309-2315.

  6. Mahajan, K. N., Nick McElhinny, S. A., Mitchell, B. S., and Ramsden, D. A. (2002) Association of DNA Polymerase Mu (Pol Mu) with Ku and Ligase IV: Role for Pol Mu in End-Joining Double-Strand Break Repair. Mol Cell Biol. 22, 5194-5202.

  7. Capp, J. P., Boudsocq, F., Besnard, A. G., Lopez, B. S., Cazaux, C., Hoffmann, J. S., and Canitrot, Y. (2007) Involvement of DNA Polymerase Mu in the Repair of a Specific Subset of DNA Double-Strand Breaks in Mammalian Cells. Nucleic Acids Res. 35, 3551-3560.

  8. Chayot, R., Danckaert, A., Montagne, B., and Ricchetti, M. (2010) Lack of DNA Polymerase Mu Affects the Kinetics of DNA Double-Strand Break Repair and Impacts on Cellular Senescence. DNA Repair (Amst). 9, 1187-1199.

  9. Pryor, J. M., Waters, C. A., Aza, A., Asagoshi, K., Strom, C., Mieczkowski, P. A., Blanco, L., and Ramsden, D. A. (2015) Essential Role for Polymerase Specialization in Cellular Nonhomologous End Joining. Proc Natl Acad Sci U S A. 112, E4537-45.

  10. Bertocci, B., De Smet, A., Flatter, E., Dahan, A., Bories, J. C., Landreau, C., Weill, J. C., and Reynaud, C. A. (2002) Cutting Edge: DNA Polymerases Mu and Lambda are Dispensable for Ig Gene Hypermutation. J Immunol. 168, 3702-3706.

  11. Lucas, D., Lain de Lera, T., Gonzalez, M. A., Ruiz, J. F., Dominguez, O., Casanova, J. C., Martinez-A, C., Blanco, L., and Bernad, A. (2005) Polymerase Mu is Up-Regulated during the T Cell-Dependent Immune Response and its Deficiency Alters Developmental Dynamics of Spleen Centroblasts. Eur J Immunol. 35, 1601-1611.