Phenotypic Mutation 'arachnoid'

• Allele: arachnoid
• Chromosome: 16
• Coordinate: 17,103,145 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Pi4ka
• Gene Name: phosphatidylinositol 4-kinase alpha
• Synonym(s): Pik4ca
• Chromosomal Location: 17,098,215-17,224,178 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014] ; PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000036162] [ENSMUSP00000122550] [ENSMUSP00000156049]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000036162; Gene: ENSMUSG00000041720

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000122550; Gene: ENSMUSG00000041720

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0898
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:29 PM by Diantha La Vine
• Record Created: 2019-01-30 1:56 PM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001001983; MGI:2448506

Alleles Listed at MGI

All Mutations and Alleles(28) : Gene trapped(21) Targeted(7)

Phenotypic Description

Figure 1. Arachnoid mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Arachnoid mice exhibit increased frequencies of peripheral CD44+ CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Arachnoid mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The arachnoid phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3953, some of which showed increased frequencies of CD44+ T cells (Figure 1), CD44+ CD4+ T cells (Figure 2), and central memory CD4 T cells in CD4 T cells (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the increased CD44+ CD4+ T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R3953. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 16: Pi4ka and Arhgap31. The mutation in Pi4ka was presumed causative as the immune phenotypes observed in the arachnoid mice mimics that of mice expressing other mutant Pi4ka alleles (see MGI). The mutation in Pi4ka is a T to C transition at base pair 17,285,281 (v38) on chromosome 16, or base pair 121,034 in the GenBank genomic region NC_000082 within the splice acceptor site of intron 44 (4-base pairs from exon 45 [out of 55 total exons]). The strongest association was found with a recessive model of inheritance to the CD44+ CD4+ T cell phenotype, wherein one variant homozygote departed phenotypically from six homozygous reference mice and nine heterozygous mice with a P value of 1.226 x 10^-5 (Figure 4).  

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to not affect splicing of the mRNA sequence NM_001001983. If the mutation does affect splicing, the most likely aberrant splicing result with cause skipping of the 71-base pair exon 45. The aberrant splicing would cause a frame-shifted protein product beginning after amino acid 1,691 of the protein, which is normally 2,044 amino acids in length, and termination after the inclusion of seven aberrant amino acids.

<--exon 44      <--intron 44 exon 45-->      exon 46--> 5140 ……GCCATCATCAA ……tgtcttattcctcag GCCCTACCCTAAA…… GCTGCTACCTGCCCAGCAACCCTGA…… 1688 ……-A--I--I--K                   --P--Y--P--K-…… --L--L--P--A--Q--Q--P--*-          correct                        deleted               aberrant

The acceptor splice site of intron 44, which is destroyed by the arachnoid mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 5. Domain organization of PI4KIIIα. The arachnoid mutation destroys the acceptor splice site of intron 44. This image is interactive. Other mutations found in PI4KIIIα. Click on each allele for more information. Abbreviations: SH3, SRC Homology 3; NLS, Nuclear Localization Signal; LKU, Lipid Kinase Unique; PH, Pleckstrin Homology.

Pi4ka encodes phosphatidylinositol-4-kinase IIIα (PI4KIIIα; alternatively STT4), a member of the PI3/PI4-kinase family. PI4KIIIα has a Src homology domain-3 (SH3 domain, two nuclear localization signals, PI-3-kinase (PIK) accessory domain (alternatively, lipid kinase unique (LKU) domain), a pleckstrin homology (PH) domain, and a PI3K/PI4K catalytic domain (Figure 5). The role of the PIK/LKU domain is unknown, but it is predicted to promote substrate presentation [SMART; (1)]. The PI4KIIIα PH domain binds PI 4-phosphate [PI(4)P] (2) and may contribute to product inhibition (3). The PI4KIIIα catalytic domain shares sequence similarities to other PI3K/PI3K family members.

The arachnoid mutation is predicted to not affect splicing of the mRNA sequence NM_001001983 that encodes PI4KIIIα. The mutation putative affects the region surrounding the LKU domain.

Please see the record pia for more information about Pi4ka.

Putative Mechanism

PI4KIIIα is one of four enzymes that catalyzes the first step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P₂] by phosphorylating PI at the 4-position of the inositol ring to form PI(4)P (4). In the metabolism of D₄ phosphorylated PIs, PI(4)P is subsequently phosphorylated by PI(4)P 5-kinases to form PI(4,5)P₂. PI(4,5)P₂ can subsequently be phosphorylated by PI3Ks to form PI(3,4,5)P₃. PI(3,4,5)P₃ can then be converted to PI(3,4)P₂.

PI4KIIIα is required for protein trafficking from the endoplasmic reticulum to the plasma membrane (5). PI4KIIIα also promotes the PI(4)P-mediated recruitment of the guanine nucleotide exchange factor GBF1 (Golgi-specific brefeldin A resistance guanine nucleotide exchange factor 1) to Golgi membranes whereby it activates Arf1 (ADP ribosylation factor-1) (6;7). ARF1 is required for the formation of trafficking vesicles for sorting and trafficking cargo from the Golgi apparatus to several cellular destinations (e.g., lysosome and plasma membrane) (8). PI4KIIIα was identified as a factor in hematopoiesis, namely in in erythroid and myeloid maturation (9). Pi4ka mutant spleens had less lymphocytic, more HSCs, and more common myeloid progenitor (CMP) features when compared with controls.

Pi4ka-deficient mice exhibited early embryonic lethality (4). Homozygous mice expressing a kinase defective PI4KIIIα were also lethal, exhibiting mucosal epithelial degeneration in the gastrointestinal tract (10). Mice with Schwann cell-specific deletion of Pi4ka showed myelination defects as well as reduced levels of the lipids phosphatidylserine, phosphatidylethanolamine, and sphingomyelin in the nerves (11).

The phenotypes of the arachnoid mice indicate loss of PI4KIIIα-associated function. However, lethality was not observed in homozygous arachnoid mice indicating that some function was retained.

Primers

PCR Primer
arachnoid_pcr_F: GTTGTATGCTGAAGGGCCTAAG
arachnoid_pcr_R: CAACTTAAGCCTGGTAGAGCC

Sequencing Primer
arachnoid_seq_F: GCCTAAGTGTGCAATGTAGC
arachnoid_seq_R: GTTATCAGTGAAGAGGACAATGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 16, - strand):

1   caacttaagc ctggtagagc caggtgtggt tgggttatca gtgaagagga caatgtcctg
61  agcaaaaact ggaaaccagt ttctgcagga gacagagcag aatcttttgt ttatttagat
121 gattgatgta acccaaactg gcctcaaact cactgtaaac tcacttaaat caggcctcca
181 gatctgagag ttgaggtcca gtcaccacgt tctgtcttat tcctcaggcc ctaccctaaa
241 ggcgatgaaa ggaagaaggc ttgtctgtca gctctgtctg aagtgaaggt gcagcctggt
301 aagctggcat ccgtaggcta gtgaggcaaa gggagctact gtcctacgtg ggatgaggcc
361 agccagctac attgcacact taggcccttc agcatacaac 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Flanagan, C. A., Schnieders, E. A., Emerick, A. W., Kunisawa, R., Admon, A., and Thorner, J. (1993) Phosphatidylinositol 4-Kinase: Gene Structure and Requirement for Yeast Cell Viability. Science. 262, 1444-1448.

  2. Stevenson, J. M., Perera, I. Y., and Boss, W. F. (1998) A Phosphatidylinositol 4-Kinase Pleckstrin Homology Domain that Binds Phosphatidylinositol 4-Monophosphate. J Biol Chem. 273, 22761-22767.

  3. Stevenson-Paulik, J., Love, J., and Boss, W. F. (2003) Differential Regulation of Two Arabidopsis Type III Phosphatidylinositol 4-Kinase Isoforms. A Regulatory Role for the Pleckstrin Homology Domain. Plant Physiol. 132, 1053-1064.

  4. Nakatsu, F., Baskin, J. M., Chung, J., Tanner, L. B., Shui, G., Lee, S. Y., Pirruccello, M., Hao, M., Ingolia, N. T., Wenk, M. R., and De Camilli, P. (2012) PtdIns4P Synthesis by PI4KIIIalpha at the Plasma Membrane and its Impact on Plasma Membrane Identity. J Cell Biol. 199, 1003-1016.

  5. Bryant, K. L., Baird, B., and Holowka, D. (2015) A Novel Fluorescence-Based Biosynthetic Trafficking Method Provides Pharmacologic Evidence that PI4-Kinase IIIalpha is Important for Protein Trafficking from the Endoplasmic Reticulum to the Plasma Membrane. BMC Cell Biol. 16, 5-015-0049-5.

  6. Dumaresq-Doiron, K., Savard, M. F., Akam, S., Costantino, S., and Lefrancois, S. (2010) The Phosphatidylinositol 4-Kinase PI4KIIIalpha is Required for the Recruitment of GBF1 to Golgi Membranes. J Cell Sci. 123, 2273-2280.

  7. Niu, T. K., Pfeifer, A. C., Lippincott-Schwartz, J., and Jackson, C. L. (2005) Dynamics of GBF1, a Brefeldin A-Sensitive Arf1 Exchange Factor at the Golgi. Mol Biol Cell. 16, 1213-1222.

  8. Dell'Angelica, E. C., Puertollano, R., Mullins, C., Aguilar, R. C., Vargas, J. D., Hartnell, L. M., and Bonifacino, J. S. (2000) GGAs: A Family of ADP Ribosylation Factor-Binding Proteins Related to Adaptors and Associated with the Golgi Complex. J Cell Biol. 149, 81-94.

  9. Ziyad, S., Riordan, J. D., Cavanaugh, A. M., Su, T., Hernandez, G. E., Hilfenhaus, G., Morselli, M., Huynh, K., Wang, K., Chen, J. N., Dupuy, A. J., and Iruela-Arispe, M. L. (2018) A Forward Genetic Screen Targeting the Endothelium Reveals a Regulatory Role for the Lipid Kinase Pi4ka in Myelo- and Erythropoiesis. Cell Rep. 22, 1211-1224.

  10. Vaillancourt, F. H., Brault, M., Pilote, L., Uyttersprot, N., Gaillard, E. T., Stoltz, J. H., Knight, B. L., Pantages, L., McFarland, M., Breitfelder, S., Chiu, T. T., Mahrouche, L., Faucher, A. M., Cartier, M., Cordingley, M. G., Bethell, R. C., Jiang, H., White, P. W., and Kukolj, G. (2012) Evaluation of Phosphatidylinositol-4-Kinase IIIalpha as a Hepatitis C Virus Drug Target. J Virol. 86, 11595-11607.

  11. Alvarez-Prats, A., Bjelobaba, I., Aldworth, Z., Baba, T., Abebe, D., Kim, Y. J., Stojilkovic, S. S., Stopfer, M., and Balla, T. (2018) Schwann-Cell-Specific Deletion of Phosphatidylinositol 4-Kinase Alpha Causes Aberrant Myelination. Cell Rep. 23, 2881-2890.