Phenotypic Mutation 'justinian'

• Allele: justinian
• Mutation Type: missense
• Chromosome: 14
• Coordinate: 20,558,611 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Ppp3cb
• Gene Name: protein phosphatase 3, catalytic subunit, beta isoform
• Synonym(s): Cnab, CnAbeta, 1110063J16Rik, Calnb, PP2BA beta
• Chromosomal Location: 20,549,432-20,596,641 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000022355] [ENSMUSP00000125722] [ENSMUSP00000125630] [ENSMUSP00000125582]
• AlphaFold: P48453
• SMART Domains: Protein: ENSMUSP00000022355; Gene: ENSMUSG00000021816

Domain	Start	End	E-Value	Type
low complexity region	2	20	N/A	INTRINSIC
PP2Ac	65	356	5.03e-166	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000125722; Gene: ENSMUSG00000021816

Domain	Start	End	E-Value	Type
low complexity region	2	20	N/A	INTRINSIC
PP2Ac	65	356	5.03e-166	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000125630; Gene: ENSMUSG00000021816

Domain	Start	End	E-Value	Type
low complexity region	2	20	N/A	INTRINSIC
PP2Ac	65	356	5.03e-166	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000125582; Gene: ENSMUSG00000021816; AA Change: C484R

Domain	Start	End	E-Value	Type
low complexity region	2	20	N/A	INTRINSIC
PP2Ac	65	356	5.03e-166	SMART
low complexity region	487	497	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
  (Using ENSMUST00000161989)
• Meta Mutation Damage Score: 0.0647
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:29 PM by Anne Murray
• Record Created: 2019-01-30 1:59 PM by Bruce Beutler
• Record Posted: 2019-02-08
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008914 (variant 1), NM_001310426 (variant 2), NM_001310427 (variant 3); MGI:107163

Alleles Listed at MGI

All Mutations and Alleles(32) : Chemically induced (ENU)(4) Gene trapped(25) Targeted(3)

Phenotypic Description

Figure 1. Justinian mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Justinian mice exhibit reduced frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The justinian phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4085, some of which exhibited an increase in the CD4 to CD8 T cell ratio (Figure 1) due to reduced frequencies of CD8+ T cells in CD3+ T cells (Figure 2) in the peripheral blood.

Nature of Mutation

Figure 3. Linkage mapping of the increased CD4 to CD8 T cell ratio using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R4085. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Ppp3cb: a T to C transition at base pair 20,508,543 (v38) on chromosome 14, or base pair 38,031 in the GenBank genomic region NC_000080 encoding Ppp3cb. The strongest association was found with a recessive model of inheritance to the normalized CD4 to CD8 T cell ratio, wherein one variant homozygote departed phenotypically from six homozygous reference mice and five heterozygous mice with a P value of 4.427 x 10^-5 (Figure 5).

The mutation corresponds to residue 1,450 in the cDNA sequence ENSMUST00000022355.10 within exon 12 of 12 total exons.

1435 AATACACATAATGCATGCAGGGAACTCCTTCTG 479  -N--T--H--N--A--C--R--E--L--L--L-

The mutated nucleotide is indicated in red. The mutation results in a cysteine to arginine substitution at position 484 (C484R) in an alternative 497-amino acid isoform of CnAβ (ENSMUSP00000125582), and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.734).

NOTE: The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is within intron 12 (81-base pairs from exon 12) in the canonical isoform of Ppp3cb; the mutation is not predicted to affect splicing of the transcript.

Protein Prediction

Figure 4. Domain structure of CnAβ. The justinian mutation is within intron 12 in the canonical isoform of Ppp3cb. The mutation results in a cysteine to arginine substitution at position 484 in an alternative 497-amino acid isoform of CnAβ. Abbreviations: PP, poly-pro; the CnB-binding domains are indicated by a "1" and "2"; CaM, calmodulin-binding domain; Inh, inhbitory. This image is interactive. Other mutations found in CnAα are noted in red. Click on each mutation for more information.

Ppp3cb encodes calcineurin Aβ (CnAβ), a calcineurin catalytic subunit isoform. All of the CnA proteins have a catalytic domain that is highly homologous to other serine/threonine protein phosphatases (amino acids 2-310 in CnAβ) (Figure 4). Within the catalytic domain is a poly-proline motif (amino acids 11-20 in CnAβ) that is specific for the CnAβ catalytic subunit (1). The CnA proteins have three C-terminal regulatory domains that include a CnB binding domain (amino acids 256-262 and 305-310 in CnAβ), a CaM-binding domain (amino acids 401-423 in CnAβ), and an autoinhibitory domain (amino acids 474-496 in CnAβ) (1;2). Ppp3cb can be alternatively spliced upon insulin-like growth factor 1 induction to generate a CnAβ1 isoform (3). The CnAβ1 isoform does not have an autoinhibitory domain, and contains a unique C-terminal domain to CnAβ (4).

The justinian mutation results in a cysteine to arginine substitution at position 484 (C484R) in an alternative 497-amino acid isoform of CnAβ (Figure 4). The mutation is within intron 12 (81-base pairs from exon 12) in the canonical isoform of Ppp3cb; the mutation is not predicted to affect splicing of the transcript.

Please see the record Copacabana for more information about Ppp3cb.

Putative Mechanism

Calcineurin (alternatively, PP2B) is a calcium- and calmodulin (CaM)-dependent serine/threonine protein phosphatase that consists of a catalytic subunit and a regulatory calcium-binding subunit, termed calcineurin A (CnA) and calcineurin B (CnB), respectively. Calcineurin has functions in T cell activation, activation-induced cell death (AICD), T cell tolerance, ion channel regulation, cardiac myocyte hypertrophy, sperm motility, synaptic endocytosis, and Alzheimer’s disease (5-8). Upon calcineurin activation, it dephosphorylates members of the nuclear factor of activated T cells (NFAT) family, promoting their translocation from the cytosol to the nucleus and subsequent induction of the transcription of NFAT target genes such as IL-2 growth factor, IFN-γ, and IL-4.  In addition to cytokine production, calcineurin-NFAT signaling mediates T cell maturation, synaptic transmission in neurons, vascular patterning in embryonic development, hypertrophic growth of the heart, and regulation of oxidative/slow fiber content in glycolytic/fast muscles (i.e., gastrocnemius, tibialis anterior, biceps, and triceps) (9;10).

CnAβ is required for the spontaneous survival of naïve T cells (11). Naïve T cells from Ppp3cb-deficient (Ppp3cb^-/-) mice exhibited increased spontaneous apoptosis that could be blocked by IL-7 and IL-15. Ppp3cb^-/- mice exhibit a reduction in CD3⁺ T cells in the peripheral blood compared to that in wild-type mice (12). In addition, the frequency of both thymic and splenic CD4⁺ and CD8⁺ cells in the Ppp3cb^-/- mice was reduced compared to that in wild-type mice. The numbers of single positive T cells increased in the Ppp3cb^-/- mice with age to levels comparable to wild-type mice (8). Thymus cellularity was also reduced in the Ppp3cb^-/- mice. Splenic T cells from Ppp3cb^-/- mice exhibited reduced proliferation induced by CD3 cross-linking or PMA/ionomycin. CnAα is able to partially compensate for the function of CnAβ in T cell activation, but both are required for efficient cell activation. After calcineurin-induced activation, NF-AT forms a complex with FOXP3 to induce regulatory T cell (T_reg) cell generation through the induction of Il2ra (CD25) and Ctla4 (CD152) (13). Loss of CnAβ expression results in deficient T_reg cell generation with a concomitant expansion of mature T cells with an activated phenotype (8). Calcineurin has a several functions including a role in apoptosis of T and B cells (14-16) and neuronal cells (17). In lymphocytes, calcineurin and NF-AT function in apoptosis by mediating the induction of Fas and FasL, which transduce an apoptotic signal upon T cell activation (18;19).

The phenotype of the justinian mice indicates loss of CnAβ-associated function.

Primers

PCR Primer
justinian_pcr_F: TTGACTGAGGCTTTTGAAAGAAAGG
justinian_pcr_R: AAAGCGTGCTGACACTCAAG

Sequencing Primer
justinian_seq_F: GGAATTATGACATGAGCTGCTCCC
justinian_seq_R: TGACACTCAAGGGCCTGACTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 414 nucleotides is amplified (chromosome 14, - strand):

1   aaagcgtgct gacactcaag ggcctgactc ccacagggat gttgcctagt ggagtgttgg
61  ctggaggacg gcagaccttg caaagtggta atgatgttat gcaacttgct gtgcctcaga
121 tggactgggg cacaactcac tcttttgcta acaatacaca taatgcatgc agggaactcc
181 ttctgctttt tagttcctgt cttagcagct gacatatgca gggtattatg tgataggcat
241 ctgattagta cctggccagg gcataatatt gatagaacaa gttgtctttt aactgaaaat
301 aacaatcagt ttcccagatt ttcataaggt gatatgggga gcagctcatg tcataattcc
361 gaaatattta ttcatttgtt taatgcaccc ctttctttca aaagcctcag tcaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Guerini, D., and Klee, C. B. (1989) Cloning of Human Calcineurin A: Evidence for Two Isozymes and Identification of a Polyproline Structural Domain. Proc Natl Acad Sci U S A. 86, 9183-9187.

  2. Hubbard, M. J., and Klee, C. B. (1989) Functional Domain Structure of Calcineurin A: Mapping by Limited Proteolysis. Biochemistry. 28, 1868-1874.

  3. Lara-Pezzi, E., Winn, N., Paul, A., McCullagh, K., Slominsky, E., Santini, M. P., Mourkioti, F., Sarathchandra, P., Fukushima, S., Suzuki, K., and Rosenthal, N. (2007) A Naturally Occurring Calcineurin Variant Inhibits FoxO Activity and Enhances Skeletal Muscle Regeneration. J Cell Biol. 179, 1205-1218.

  4. Felkin, L. E., Narita, T., Germack, R., Shintani, Y., Takahashi, K., Sarathchandra, P., Lopez-Olaneta, M. M., Gomez-Salinero, J. M., Suzuki, K., Barton, P. J., Rosenthal, N., and Lara-Pezzi, E. (2011) Calcineurin Splicing Variant Calcineurin Abeta1 Improves Cardiac Function After Myocardial Infarction without Inducing Hypertrophy. Circulation. 123, 2838-2847.

  5. Kincaid, R. L., Takayama, H., Billingsley, M. L., and Sitkovsky, M. V. (1987) Differential Expression of Calmodulin-Binding Proteins in B, T Lymphocytes and Thymocytes. Nature. 330, 176-178.

  6. Tash, J. S., Krinks, M., Patel, J., Means, R. L., Klee, C. B., and Means, A. R. (1988) Identification, Characterization, and Functional Correlation of Calmodulin-Dependent Protein Phosphatase in Sperm. J Cell Biol. 106, 1625-1633.

  7. Sun, T., Wu, X. S., Xu, J., McNeil, B. D., Pang, Z. P., Yang, W., Bai, L., Qadri, S., Molkentin, J. D., Yue, D. T., and Wu, L. G. (2010) The Role of calcium/calmodulin-Activated Calcineurin in Rapid and Slow Endocytosis at Central Synapses. J Neurosci. 30, 11838-11847.

  8. Doetschman, T., Sholl, A., Chen, H., Gard, C., Hildeman, D. A., and Bommireddy, R. (2011) Divergent Effects of Calcineurin Abeta on Regulatory and Conventional T-Cell Homeostasis. Clin Immunol. 138, 321-330.

  9. Parsons, S. A., Wilkins, B. J., Bueno, O. F., and Molkentin, J. D. (2003) Altered Skeletal Muscle Phenotypes in Calcineurin Aalpha and Abeta Gene-Targeted Mice. Mol Cell Biol. 23, 4331-4343.

  10. Crabtree, G. R., and Olson, E. N. (2002) NFAT Signaling: Choreographing the Social Lives of Cells. Cell. 109 Suppl, S67-79.

  11. Manicassamy, S., Gupta, S., Huang, Z., Molkentin, J. D., Shang, W., and Sun, Z. (2008) Requirement of Calcineurin a Beta for the Survival of Naive T Cells. J Immunol. 180, 106-112.

  12. Bueno, O. F., Brandt, E. B., Rothenberg, M. E., and Molkentin, J. D. (2002) Defective T Cell Development and Function in Calcineurin A Beta -Deficient Mice. Proc Natl Acad Sci U S A. 99, 9398-9403.

  13. Wu, Y., Borde, M., Heissmeyer, V., Feuerer, M., Lapan, A. D., Stroud, J. C., Bates, D. L., Guo, L., Han, A., Ziegler, S. F., Mathis, D., Benoist, C., Chen, L., and Rao, A. (2006) FOXP3 Controls Regulatory T Cell Function through Cooperation with NFAT. Cell. 126, 375-387.

  14. Bonnefoy-Berard, N., Genestier, L., Flacher, M., and Revillard, J. P. (1994) The Phosphoprotein Phosphatase Calcineurin Controls Calcium-Dependent Apoptosis in B Cell Lines. Eur J Immunol. 24, 325-329.

  15. Fruman, D. A., Mather, P. E., Burakoff, S. J., and Bierer, B. E. (1992) Correlation of Calcineurin Phosphatase Activity and Programmed Cell Death in Murine T Cell Hybridomas. Eur J Immunol. 22, 2513-2517.

  16. Zhao, Y., Tozawa, Y., Iseki, R., Mukai, M., and Iwata, M. (1995) Calcineurin Activation Protects T Cells from Glucocorticoid-Induced Apoptosis. J Immunol. 154, 6346-6354.

  17. Asai, A., Qiu, J., Narita, Y., Chi, S., Saito, N., Shinoura, N., Hamada, H., Kuchino, Y., and Kirino, T. (1999) High Level Calcineurin Activity Predisposes Neuronal Cells to Apoptosis. J Biol Chem. 274, 34450-34458.

  18. Toth, R., Szegezdi, E., Molnar, G., Lord, J. M., Fesus, L., and Szondy, Z. (1999) Regulation of Cell Surface Expression of Fas (CD95) Ligand and Susceptibility to Fas (CD95)-Mediated Apoptosis in Activation-Induced T Cell Death Involves Calcineurin and Protein Kinase C, Respectively. Eur J Immunol. 29, 383-393.

  19. Latinis, K. M., Norian, L. A., Eliason, S. L., and Koretzky, G. A. (1997) Two NFAT Transcription Factor Binding Sites Participate in the Regulation of CD95 (Fas) Ligand Expression in Activated Human T Cells. J Biol Chem. 272, 31427-31434.