Phenotypic Mutation 'Tropo'

• Allele: Tropo
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 53,531,648 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Atm
• Gene Name: ataxia telangiectasia mutated
• Synonym(s): C030026E19Rik
• Chromosomal Location: 53,439,149-53,536,740 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010] ; PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000113388] [ENSMUSP00000115394] [ENSMUSP00000156344]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000113388; Gene: ENSMUSG00000034218; AA Change: I105T

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000118282)
• SMART Domains: Protein: ENSMUSP00000115394; Gene: ENSMUSG00000034218; AA Change: I87T

Domain	Start	End	E-Value	Type
TAN	1	140	2.88e-40	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000150244)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000232179)
• Meta Mutation Damage Score: 0.7173
• Is this an essential gene?: Probably essential (E-score: 0.944)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2020-12-09 6:46 AM by External Program
• Record Created: 2019-02-01 7:40 AM by Bruce Beutler
• Record Posted: 2019-02-08
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007499; MGI:107202

Alleles Listed at MGI

All Mutations and Alleles(38) : Chemically induced (ENU)(2) Gene trapped(19) Targeted(17)

Phenotypic Description

Figure 1. Tropo mice exhibit increased frequencies of B1a cells in B1 cells . Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Tropo mice exhibit increased frequencies of macrophages . Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The tropo phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6715, some of which showed increased frequencies of B1a cells in B1 cells (Figure 1) and macrophages (Figure 2) in the peripheral blood.

Nature of Mutation

Figure 3. Linkage mapping of the increased macrophage frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 33 mutations (X-axis) identified in the G1 male of pedigree R6715. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 33 mutations. Both of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 9: Pgr and Atm. The mutation in Atm was presumed causative as the immune phenotypes observed in tropo mice mimics that of other mice expressing mutant Atm alleles (see MGI). The mutation in Atm is a T to C transition at base pair 53,531,648 (v38) on chromosome 9, or base pair 5,169 in the GenBank genomic region NC_000075. The strongest association was found with a recessive model of inheritance to the macrophage phenotype, wherein one variant homozygote departed phenotypically from eight homozygous reference mice and 13 heterozygous mice with a P value of 1.718 x 10^-25  (Figure 3).  

 

The mutation corresponds to residue 453 in the mRNA sequence NM_007499 within exon 4 of 64 total exons.

437 TTGGTCAGATACTTCATCAAATGTGCAAACAAA 100 -L--V--R--Y--F--I--K--C--A--N--K-

The mutated nucleotide is indicated in red. The mutation results in an isoleucine to threonine substitution at amino acid 105 (I105T) in the ATM protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Domain organization of ATM. The location of the tropo mutation is indicated. Mutations found in ATM are noted in red. Click on each mutation to view more information.

ATM (ataxia telangiectasia mutated) is a member of the PI3/PI4-kinase (PIKK) family. The PIKK family members DNA-PK_CS (DNA-dependent protein kinase; see clover), ATR (ATM and Rad3-related), and ATM are involved in DNA repair [(1); reviewed in (2)]. A 250-amino acid region at the C-terminus of ATM constitutes the catalytic PIKK domain (Figure 4). The PIKK domain is flanked by the FAT domain (named for its homology to FRAP, ATM and TRRAP) and a FATC domain (FAT at the extreme C-terminus). The FAT and FATC domains occur in combination in all PIKK family members, suggesting a possible role in maintaining a structural conformation essential for the activation of the catalytic site (3;4). The FAT domain mediates ATM dimerization and has three tetratriocpeptide repeat domains (TRDs). The N-terminal portion of the protein up to the FAT domain consists of HEAT (Huntingtin, Elongation factor 3, A subunit of protein phosphatase 2A and TOR1) repeats (5). HEAT repeats are helical structural repeats that mediate protein-protein interactions (6).

 

The tropo mutation results in an isoleucine to threonine substitution at amino acid 105 (I105T); amino acid 105 is within the HEAT repeat region.

 

For more information about Atm, please see the record for mockingbird.

Putative Mechanism

ATM is a cell cycle checkpoint kinase that phosphorylates proteins in several cell processes, including DNA repair, apoptosis, cell cycle checkpoints, telomere dysfunction, translation initiation, gene regulation, mitosis, and hypoxia. In all, there are 900 putative ATM/ATR phosphorylation sites on over 700 proteins in the DNA damage response (DDR) pathway alone (7).

 

Mutations in human ATM are linked to ataxia-telangiectasia [OMIM: #208900; (8;9)] and susceptibility to breast cancer (OMIM: #114480) as well as somatic B-cell non-Hodgkin lymphoma, somatic mantle cell lymphoma, and somatic T-cell prolymphocytic leukemia. Ataxia-telangiectasia is characterized by progressive cerebellar ataxia due to premature degeneration of Purkinje and granule cells, telangiectasia (dilated blood vessels), growth retardation, gonadal atrophy, immune defects, and a predisposition to malignancy (lymphoma, leukemia, and breast cancer). Fibroblasts from ataxia-telangiectasia patients exhibit aberrant gross morphology and cytoskeletal organization, poor cell growth, defective cell-cycle checkpoints, telomere loss, and chromosome end-to-end associations.

 

Atm­-deficient (Atm^-/-) mice exhibited reduced body weights, increased incidence of T-cell-derived lymphoma, premature death (median survival is 113 days), reduced numbers of CD4+ and CD8+ T cells, reduced numbers of CD3/CD4 and CD3/CD8 T cells, reduced numbers of active T cells, reduced numbers of pre-B cells, reduced levels of IgG, male and female infertility, hypoactivity, impaired coordination, impaired glucose tolerance, and insulin resistance (10-18). B cells from the Atm^-/- mice exhibited reduced class switch recombination with increased genomic instability after tamoxifen treatment compared to cells from wild-type mice (19). Homozygous mice expressing a kinase dead mutant Atm allele exhibited embryonic lethality from embryonic day (E) 9.5 to E10.5 (19). Homozygous mice expressing a mutant Atm allele (a 9 base pair in-frame deletion in exon 54 resulting in deletion of Ser2556-Arg2557-Iso2558 in the protein) exhibited premature death by 40 weeks of age (50%), reduced body size, increased tumor incidence, increased numbers of double-negative and single-positive T cells, reduced thymocyte numbers, and male infertility (16). The phenotype of the tropo mice indicates loss of ATM-associated function.

Primers

PCR Primer
Tropo_pcr_F: GCTACGCTAACTCCTGAAGC
Tropo_pcr_R: ACAAGAGATTGTTTCATGTGTCTGG

Sequencing Primer
Tropo_seq_F: ACGCTAACTCCTGAAGCATTTGTG
Tropo_seq_R: TGGTACAACAGTGTGGTTTAAAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 511 nucleotides is amplified (chromosome 9, - strand):

1   acaagagatt gtttcatgtg tctggttggt acaacagtgt ggtttaaaag atgttttggg
61  ggaagataca caggagtttt tgaagtgata aaagtataag cattaatgag gatatgattt
121 atttttcctt gaaggttttt acagaagtac attcaaaaag aaatggaaag tctgagaaca
181 gcaaaatcaa atgtatcagc caccacacag agctccagac agaagaagat gcaagagatc
241 agcagtttgg tcagatactt catcaaatgt gcaaacaaaa gtaagtaacc ttggctgcgt
301 gtggtggcac acactgctgt ggtggcgcac acctttagtc ccagcactca aaaggcagag
361 gcaggtggat ctatagccta gcctggacta tagagtgagt tccaggacag ccagggctac
421 acagagaaac cctgcctcaa aaaacccaaa gcaacaaaaa acgtaaacaa catcatgtat
481 tacacacaaa tgcttcagga gttagcgtag c

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Falck, J., Coates, J., and Jackson, S. P. (2005) Conserved Modes of Recruitment of ATM, ATR and DNA-PKcs to Sites of DNA Damage. Nature. 434, 605-611.

  2. Abraham, R. T. (2001) Cell Cycle Checkpoint Signaling through the ATM and ATR Kinases. Genes Dev. 15, 2177-2196.

  3. Dip, R., and Naegeli, H. (2005) More than just Strand Breaks: The Recognition of Structural DNA Discontinuities by DNA-Dependent Protein Kinase Catalytic Subunit. FASEB J. 19, 704-715.

  4. Hill, R., and Lee, P. W. (2010) The DNA-Dependent Protein Kinase (DNA-PK): More than just a Case of Making Ends Meet? Cell Cycle. 9, 3460-3469.

  5. Perry, J., and Kleckner, N. (2003) The ATRs, ATMs, and TORs are Giant HEAT Repeat Proteins. Cell. 112, 151-155.

  6. Andrade, M. A., Perez-Iratxeta, C., and Ponting, C. P. (2001) Protein Repeats: Structures, Functions, and Evolution. J Struct Biol. 134, 117-131.

  7. Matsuoka, S., Ballif, B. A., Smogorzewska, A., McDonald, E. R.,3rd, Hurov, K. E., Luo, J., Bakalarski, C. E., Zhao, Z., Solimini, N., Lerenthal, Y., Shiloh, Y., Gygi, S. P., and Elledge, S. J. (2007) ATM and ATR Substrate Analysis Reveals Extensive Protein Networks Responsive to DNA Damage. Science. 316, 1160-1166.

  8. Buzin, C. H., Gatti, R. A., Nguyen, V. Q., Wen, C. Y., Mitui, M., Sanal, O., Chen, J. S., Nozari, G., Mengos, A., Li, X., Fujimura, F., and Sommer, S. S. (2003) Comprehensive Scanning of the ATM Gene with DOVAM-S. Hum Mutat. 21, 123-131.

  9. Savitsky, K., Bar-Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle, D. A., Smith, S., Uziel, T., Sfez, S., Ashkenazi, M., Pecker, I., Frydman, M., Harnik, R., Patanjali, S. R., Simmons, A., Clines, G. A., Sartiel, A., Gatti, R. A., Chessa, L., Sanal, O., Lavin, M. F., Jaspers, N. G., Taylor, A. M., Arlett, C. F., Miki, T., Weissman, S. M., Lovett, M., Collins, F. S., and Shiloh, Y. (1995) A Single Ataxia Telangiectasia Gene with a Product Similar to PI-3 Kinase. Science. 268, 1749-1753.

  10. Barlow, C., Hirotsune, S., Paylor, R., Liyanage, M., Eckhaus, M., Collins, F., Shiloh, Y., Crawley, J. N., Ried, T., Tagle, D., and Wynshaw-Boris, A. (1996) Atm-Deficient Mice: A Paradigm of Ataxia Telangiectasia. Cell. 86, 159-171.

  11. Genik, P. C., Bielefeldt-Ohmann, H., Liu, X., Story, M. D., Ding, L., Bush, J. M., Fallgren, C. M., and Weil, M. M. (2014) Strain Background Determines Lymphoma Incidence in Atm Knockout Mice. Neoplasia. 16, 129-136.

  12. Treuner, K., Helton, R., and Barlow, C. (2004) Loss of Rad52 Partially Rescues Tumorigenesis and T-Cell Maturation in Atm-Deficient Mice. Oncogene. 23, 4655-4661.

  13. Morales, M., Theunissen, J. W., Kim, C. F., Kitagawa, R., Kastan, M. B., and Petrini, J. H. (2005) The Rad50S Allele Promotes ATM-Dependent DNA Damage Responses and Suppresses ATM Deficiency: Implications for the Mre11 Complex as a DNA Damage Sensor. Genes Dev. 19, 3043-3054.

  14. Xu, Y., Ashley, T., Brainerd, E. E., Bronson, R. T., Meyn, M. S., and Baltimore, D. (1996) Targeted Disruption of ATM Leads to Growth Retardation, Chromosomal Fragmentation during Meiosis, Immune Defects, and Thymic Lymphoma. Genes Dev. 10, 2411-2422.

  15. Borghesani, P. R., Alt, F. W., Bottaro, A., Davidson, L., Aksoy, S., Rathbun, G. A., Roberts, T. M., Swat, W., Segal, R. A., and Gu, Y. (2000) Abnormal Development of Purkinje Cells and Lymphocytes in Atm Mutant Mice. Proc Natl Acad Sci U S A. 97, 3336-3341.

  16. Spring, K., Cross, S., Li, C., Watters, D., Ben-Senior, L., Waring, P., Ahangari, F., Lu, S. L., Chen, P., Misko, I., Paterson, C., Kay, G., Smorodinsky, N. I., Shiloh, Y., and Lavin, M. F. (2001) Atm Knock-in Mice Harboring an in-Frame Deletion Corresponding to the Human ATM 7636del9 Common Mutation Exhibit a Variant Phenotype. Cancer Res. 61, 4561-4568.

  17. Elson, A., Wang, Y., Daugherty, C. J., Morton, C. C., Zhou, F., Campos-Torres, J., and Leder, P. (1996) Pleiotropic Defects in Ataxia-Telangiectasia Protein-Deficient Mice. Proc Natl Acad Sci U S A. 93, 13084-13089.

  18. Takagi, M., Uno, H., Nishi, R., Sugimoto, M., Hasegawa, S., Piao, J., Ihara, N., Kanai, S., Kakei, S., Tamura, Y., Suganami, T., Kamei, Y., Shimizu, T., Yasuda, A., Ogawa, Y., and Mizutani, S. (2015) ATM Regulates Adipocyte Differentiation and Contributes to Glucose Homeostasis. Cell Rep. .

  19. Yamamoto, K., Wang, Y., Jiang, W., Liu, X., Dubois, R. L., Lin, C. S., Ludwig, T., Bakkenist, C. J., and Zha, S. (2012) Kinase-Dead ATM Protein Causes Genomic Instability and Early Embryonic Lethality in Mice. J Cell Biol. 198, 305-313.