Phenotypic Mutation 'zeitgeist' (pdf version)
Gene Symbol Med30
Gene Name mediator complex subunit 30
Synonym(s) 1810038N03Rik; 2510044J04Rik; thyroid hormone receptor-associated protein 6 (Thrap6); thyroid hormone receptor-associated protein, 25-kD (Trap25); TRAP/Mediator complex component TRAP25
Accession Number

NCBI RefSeq: NM_027212; MGI: 1917040

Allele zeitgeist
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 15
Chromosomal Location 52,712,445-52,730,431 bp (+)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
A to T at 52,712,639 bp (GRCm38)
Amino Acid Change Isoleucine changed to Phenylalanine
Ref Sequences
I44F in : NP_081488.1 (fasta)
SMART Domains

DomainStartEndE-ValueType
Pfam:Med30 29 178 6.5e-60 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using : NP_081488.1)
Phenotypic Category cardiovascular system, hematopoietic system, life span-post-weaning/aging, NK cell deficiency
Penetrance  
Alleles Listed at MGI

All alleles(3) : Gene trapped(3)

Lab Alleles APN: IGL01065:Med30
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository

MMRRC:036549-MU

Last Updated 12/12/2013 6:56 PM by Stephen Lyon
Record Created unknown
Record Posted 02/22/2012
Phenotypic Description
Figure 1. Impaired cytotoxicity of NK cells from the zeitgeist index mouse. Shown are the results from screened G3 mice, unmutagenized C57BL/6J positive controls, and AP1 deficient animals used as negative controls.
Figure 2. Reduced lifespan exhibited by zeitgeist mice (A) and increased numbers of erythroid precursors in zeitgeist mice (B).
Figure 3.  Zeitgeist homozygotes develop myocardial fibrosis and heart failure. Histological and functional analysis of mutant hearts shortly before death. (A) H&E staining of myocardium. (Scale bars, 100 μm.) (B) Masson's trichrome staining of the ventricular wall. Arrows show regions with cardiomyocyte necrosis and asterisks areas of prominent fibrosis. (Scale bars, 100 μm.) (C) Echocardiography of mutant and control hearts. (Scale bars, 0.5 cm.) (D) LV internal dimension in diastole (LVIDd) and ejection fraction (EF) as a function of age. n = 3 for wild-type; n = 5 for mutant mice.  Figure obtained from: (1).
Figure 4.  Altered ultrastructure and defective function of Med30zg/zg mitochondria. (A) Electron micrographs of LV sections from 34-d-old wild-type and mutant mice. Arrows indicate disarrayed Z bands and asterisks aberrant mitochondria. (Scale bars, 1 μm.) (B) High magnification view of aberrant mitochondria. Asterisks indicate membranous swirls. (Scale bar, 500 nm.) (C and D) Cardiomyocytes of 3-wk-old mutant mice display normal myofibrillar structure; ultrastructural and histological alterations are visible in mutant mice ≥ 4 wk old. Electron micrographs of LV sections of Med30zg/zg hearts on day 23 (C) and day 31 (D). (Scale bars, 10 μm.) Asterisks indicate intercalated fibroblasts and arrows disarrayed Z bands. (E) An isolated cardiomyocyte from a 31-d-old Med30zg/zg LV. Arrows show examples of defective mitochondria. (Scale bar, 2 μm.) (F) Measurements of respiratory chain function in cardiac mitochondria relative to citrate synthase (CS) activity in 32-d-old hearts. Complex I activity (**P = 0.0076), oxygen consumption (O2) (*P = 0.0434), and coupling efficiency (*P = 0.0173) were measured. n = 3. Values are represented as mean ± SEM. (G) In situ activity of Complex II and Complex IV in day 39 LV as measured by staining for succinate dehydrogenase and cytochrome c oxidase, respectively. (Scale bars, 100 μm.).  Figure obtained from: (1).

The zeitgeist mutation was initially identified in an in vivo natural killer (NK) cell and CD8+ cytotoxic T lymphocyte (CTL) screen.  G3 mice were immunized with irradiated 5E1 cells (syngeneic class I MHC-deficient cells transformed by human adenovirus type 5 early region 1). One week later, the same mice were injected with three target cell populations: control C57BL/6J cells, NK cell-specific target cells (syngeneic class I MHC-deficient cells), and an antigen-specific CTL target population (C57BL/6J splenocytes externally loaded with the adenovirus E1B protein).  The zeitgeist index mouse displayed reduced NK cell cytotoxicity although the phenotype is weak (Figure 1).  In general, zeitgeist animals display lymphopenia with reduced levels of T , B, and NK cells in the spleen .  They also display an atrophied thymus, which may indicate a defect in thymus development.  No spenomegaly or hepatomegaly is observed.

 

Zeitgeist mice have a reduced lifespan and exhibit a spontaneous, progressive and rapidly appearing wasting disease with death occurring 2-3 days after symptoms first appear (Figure 2A).  Additionally, the numbers of erythropoietic progenitors expressing Ter119 are very high in zeitgeist mice, which may be a consequence of anemia (Figure 2B).  Some of the mice exhibit internal bleeding.  Homozygous zeitgeist mice were born at low frequencies to heterozygous parents, indicating that attrition of homozygotes occurs prenatally, results indicate sometime after gestational day 15.5 (1)Zeitgeist mice appear similar to their littermates at weaning, but develop progressive cardiomyopathy that is fatal by 7 wk of age (1).  Further studies indicate that these mice die of heart failure as a result of myocardial necrosis, fibrosis, and impairment of myocardial contractility (Figure 3) (1).  Electron microscopic examination of cardiomyocytes from homozygous zeitgeist mice found that there was disorganization of the Z-band pattern and shortening of I bands (1).  Mitochondrial morphology was also affected (i.e. cristolysis and formation of membranous swirls), with deterioration and dysfunction observed (Figure 4) (1). The function of other organs (e.g. liver and kidneys) was intact (1).

Nature of Mutation
The zeitgeist mutation was mapped to Chromosome 15, and corresponds to an A to T transversion at position 195 of the Med30 transcript, in exon 1 of 4 total exons.
 
180 GAGACCGTGCAGGACATCGTGTACCGCACCATG
39  -E--T--V--Q--D--I--V--Y--R--T--M-
 
The mutated nucleotide is indicated in red lettering, and results in an isoleucine to phenylalanine substitution at amino acid 44 of the Med30 protein.
Protein Prediction

Mediator complex

The multiprotein Mediator complex (Mediator) is an essential element of the RNA polymerase II (pol II) transcriptional machinery. Mediator acts as an adaptor to transmit regulatory information from transcriptional activators (i.e. transcription factors) bound at upstream promoters and enhancers to RNA pol II and the general initiation factors at the core promoter (2-4). Mediator was first purified biochemically as a 21-subunit, 1 megadalton complex from yeast (see Introduction) (5).  Soon after, several Mediator-like complexes containing around 30 subunits each were isolated from mammalian cells. These complexes, purified from different cell types using different procedures, contained distinct subunit compositions, although there were many overlaps. It may be that differences in subunit composition reflect the existence of functionally distinct, tissue- or cell type-specific forms of Mediator. Whether any of the mammalian complexes were related to yeast Mediator was doubted for some time, and initially orthologs of only eight of the yeast Mediator subunits could be identified among the mammalian subunits in pairwise sequence alignments (6).

 

It is now well established that functionally homologous Mediator complexes with some degree of similarity in subunit composition, and in the sequences of those subunits, are present in all eukaryotic organisms [reviewed in (3;4)]. Through multisequence analysis of Mediator complex proteins across a range of eukaryotic species, short regions of similarity were identified between subunits of plant, worm, insect, or mammalian Mediator-like complexes and all but three yeast Mediator subunits (7-10). These conserved regions have been proposed to comprise the interfaces between subunits in the Mediator complex, which may indicate a similar organization of subunits within Mediator complexes across species (11). While this remains to be proved, mediator complexes isolated from yeast and mammalian cells and analyzed by single-particle electron microscopy (EM) have revealed a similar overall size and shape. The yeast complex is a discrete entity with an elongated, somewhat conical shape, approximately 400 Å in length, with a large, separate domain forming the bottom portion of the structure (subsequently termed the “head” domain) (12-14). Mouse and human Mediator complexes show a rough resemblance to the yeast Mediator, having a sort of head domain separated from the rest of the complex (13;15;16).

 

Unfortunately, few structural studies of the individual Mediator subunits have been performed, and motifs conserved across species are typically short and distantly spaced, making it possible that subunit structure varies in different species. However, the conserved regions, which may form important sites of contact for other subunits, transcriptional activators, or components of RNA pol II, may exhibit more structural conservation, as seen for example with the activator-binding KIX domains of human and yeast Med15 (Gal11p) (17;18).

 

Upon incubation with an equimolar amount of RNA pol II, the conformation of yeast Mediator changes from the compact form of the free complex to an extended form in which three domains (head, middle and tail domains ) are clearly distinguishable by electron microscopy (12). The Mediator complex surrounds RNA pol II, making apparent contacts with the largest of the three domains, the head domain, and with the middle domain (19). Interaction between Mediator and RNA pol II occurs in a complex with the general initiation factor TFIIF, and is mediated by the carboxy-terminal domain (CTD) of Rpb1 (the largest subunit of RNA pol II) and the head domain of Mediator (12;20;21).  The CTD is required for activation of transcription by Mediator in both yeast and mammalian cells (16;22;23), and CTD hyperphosphorylation results in dissociation of the Mediator-pol II interaction (24). The tail domain appears to form contacts with gene-specific transcription factors (25) Transition from a compact to a more extended form is also observed after incubation of the human Mediator complex with human RNA pol II (15;16). The human Mediator-pol II complex displays a similar conformation as Mediator bound to the viral transactivator VP16; the significance of this observation is unknown.

 

Evidence from chromatographic, immunoprecipitation, mutational, reconstitution, and two-hybrid studies of yeast Mediator indicates that the constituent subunits are associated into four distinct modules (11;20;26-31). Three of these modules comprise “core Mediator”, and are thought to correspond to the head, middle, and tail domains seen in the extended Mediator structure. The various subunits have been mapped to the head, middle, or tail domains based on the EM structure of a yeast Mediator complex lacking Med16 (Sin4) (Table 1) (13). In the projection map of this mutant complex, the tail domain is absent, indicating that this portion of the Mediator complex is formed by a set of physically interacting subunits lost upon deletion of Med16, including Med16, Med15 (Gal11), Med2, and Med3 (Pgd1). Med14 (Rgr1) has been shown to physically associate with Med16, and is also thought to be part of the tail domain (32). Med14 links the subunits of the tail domain with the rest of the Mediator complex (28). The head module is comprised of a group of genetically and biochemically interacting subunits including Med6, Med17 (Srb4), Med20 (Srb2), Med18 (Srb5), Med22 (Srb6), and Med19 (Rox3) (21;33;34). The remaining subunits were deduced to constitute the middle domain.

 
Table 1. Yeast and mammalian Mediator complexes.
HEAD
Yeast
Mammal
MIDDLE
Yeast
Mammal
TAIL
Yeast
Mammal
Kinase
Yeast
Mammal
Unassigned
Yeast
Mammal
MED6
X
X
MED1
X
X
MED2
X
 
Cdk8
X
X
MED23
 
X
MED8
X
X
MED4
X
X
MED3
X
 
Cdk11
 
X
MED24
 
X
MED11
X
X
MED5
X
 
MED14
X
X
Cyclin C
X
X
MED25
 
X
MED17
X
X
MED7
X
X
MED15
X
X
Med12L
 
X
MED26
 
X
MED18
X
X
MED9
X
X
MED16
X
X
MED12
X
X
MED27
 
X
MED19
X
X
MED10
X
X
 
 
 
MED13L
 
X
MED31
X
X
MED20
X
X
MED21
X
X
 
 
 
MED13
X
X
 
 
 
MED22
X
X
 
 
 
 
 
 
 
 
 
 
 
 
MED28
 
X
 
 
 
 
 
 
 
 
 
 
 
 
MED29
 
X
 
 
 
 
 
 
 
 
 
 
 
 
MED30
 
X
 
 
 
 
 
 
 
 
 
 
 
 
Mediator subunits identified in yeast or any of the mammalian complexes isolated to date (see text for references) are indicated. Subunits are grouped according to their predicted location in the head, middle, tail, or kinase modules. Yeast Med19 was not identified in the head module in reference (21). Med30 may reside in either the head or middle modules (8).
 

The fourth yeast Mediator module, the Cdk8 subcomplex or kinase module, is comparatively labile, and was not present in the yeast Mediator preparations used for the EM studies. The kinase module includes Cdk8, cyclin C (Srb11), Med12 (Srb8), and Med13 (Srb9), and is often associated with a transcriptional repressive function in yeast and mammals (15;35;36). The kinase module has been shown to prevent binding of Mediator to RNA pol II through steric hindrance (37). However, genome-wide localization of core Mediator and the kinase module in yeast (both S. cerevisiae and S. pombe) revealed similar binding patterns, with the kinase module present even at highly transcribed genes (38;39). Furthermore, core Mediator was found associated with inactive genes (39). Thus, the kinase module is likely to be regulated at the level of activity, rather than at the level of recruitment to promoters.

 
Figure 5. Domain structure of MED30. The zeitgeist mutation results in an isoleucine to phenylalanine substitution at amino acid 44 of the protein.

Mediator complex subunit 30 (Med30)

Little is known about the protein domains or structure of Med30. Homologs of Med30 are not found in yeast or worms, suggesting that the protein may be specific to Mediator signaling in higher metazoans (40). It is a 20 kD, 178 amino acid protein, with a predicted coiled coil domain located between residues 133 and 174 (SMART, http://smart.embl-heidelberg.de/) (Figure 5). Immunodepletion of Med30 from HeLa cells using an antibody generated against the full length protein also depletes most other Mediator subunits, indicating that Med30 is a genuine component of the Mediator complex (40). Purified recombinant Med30 interacts with Med22 and Med17 (components of the head domain), with Med4 (middle domain), and with Med27 (not assigned to any domain) (8). Med30 may therefore be present in either the head or middle domains. Mouse Med30 is 94% identical to human Med30, and 38% identical to fly Med30.

 
The zeitgeist mutation results in an isoleucine to phenylalanine substitution at amino acid 44 of the 178 amino acid protein; the isoleucine at aa 44 is conserved in all vertebrate and invertebrate species examined (1).  Complementation studies between a gene-trap null allele of Med30 and zeitgeist animals did not produce compound heterozygotes, indicating that the zeitgeist mutation is hypomorphic and embryonic lethal when placed in trans with a null allele of Med30 (1).
Expression/Localization

Northern blot analysis demonstrates ubiquitous Med30 expression in all human tissues examined (heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas), with relatively elevated levels in heart, placenta, and skeletal muscle (40). ESTs representing mouse Med30 are found in highest proportion in the thymus [172 TPM (Med30 transcripts per million thymus-specific transcripts], followed by the thyroid (112 TPM) (NCBI Unigene).   Med30 ESTs are found in the following tissues:

 
Table 2. Med30 EST expression in tissues.
Tissue
TPM (Mouse)
(descending order)
TPM (Human)
thymus
172
12
thyroid
112
0
spleen
73
0
blood
58
0
liver
45
0
ovary
36
48
fertilized ovum
36
ND
mammary gland
26
19
extraembryonic tissue
26
ND
embryonic tissue
22
0
bone marrow
21
0
pancreas
18
9
skin
16
0
kidney
16
0
eye
15
23
intestine
11
0
lung
10
11
brain
4
14
bone
0
27
heart
0
11
lymph node
0
76
From NCBI Unigene EST Profiles for mouse and human
TPM, transcripts per million. ND, not determined. Not all tissues analyzed are included in table.
 

Like all Mediator subunits, Med30 is localized in the nucleus (40).

 

Background

It was initially believed (incorrectly) that transcriptional activators directly contacted the RNA pol II transcriptional machinery. Thus, interference with activator-dependent pol II transcription by overexpression of a different activator was thought to occur because of competition between the activators for a common target component of RNA pol II, such as one of the general initiation factors (41). However, it was later shown that addition of an excess of any of the general initiation factors failed to relieve the interference, while addition of a crude protein fraction restored high levels of transcription (42). The activity of this fraction, termed Mediator, provided the first evidence, in yeast, for the existence of an intermediary between transcriptional activators and RNA pol II. The crude protein fraction containing yeast Mediator was subsequently shown to activate transcription in a reconstituted yeast pol II transcription system (43), but it took purification of each required component to obtain a fully defined reconstituted transcription system that would provide consistent activity upon addition of Mediator (44). Using this system, the yeast Mediator complex was purified to homogeneity (5). Interestingly, many Mediator subunits were also identified in yeast genetic screens for mutations affecting transcriptional regulation, although their function in a bridging complex between transcriptional activators and RNA pol II was unknown at the time (45;46)

 

Later on, Mediator complexes were independently isolated from a variety of mammalian cell types. These complexes included TRAP (thyroid hormone receptor-associated proteins) (47), mouse Mediator (23), human mediator (48), CRSP (cofactor required for Sp1 activation) (49), DRIP (vitamin D receptor-interacting proteins) (50), NAT (negative regulator of activated transcription) (51), SMCC (SRB-mediator-containing cofactor) (52), and ARC (activator-recruited factor) (53). ARC has been shown to interact with VP16, adenovirus E1A, SREBP-1a, and the p65 subunit of NF-κB, and has been purified using affinity chromatography on the basis of these interactions (48;53).  Mediator is required for both activator-dependent and basal transcription in mammalian cells (40;54;55).

 
Figure 6. Transcription activation. Activators bind to their target at the upstream activation sequence (UAS), recruiting Mediator. The TATA-binding protein (TBP) subunit of transcription factor IID binds to the promotor TATA box and recruits IIA and IIB. Mediator then recruits RNA polymerase II (Pol II) to the pre-initiation complex along with IIF, followed by IIE and IIH. Upon initiation, RNA polymerase II is released from the complex and begins transcription.

How does Mediator regulate activator-dependent RNA pol II transcription? Evidence indicates that Mediator is intimately involved in preinitiation complex (PIC) assembly, increasing the efficiency of the stepwise formation of the PIC at promoters (Figure 6). Mouse embryonic stem cells lacking Med23 (not present in yeast) fail to recruit Mediator or form a PIC at promoters controlled by adenovirus E1A and Elk1, specific binding partners for Med23 (56). This finding illustrates the gene-specific recruitment of Mediator via interaction of transcriptional activators with a particular Mediator subunit (see below). Biochemical experiments using in vitro transcription systems have shown that assembly of a Mediator/TFIIA/TFIID complex on promoter DNA is a rate-limiting step in both basal and activator-dependent transcription, after which Mediator may recruit pol II and other general initiation factors (55;57-59). Mediator also serves to coordinate PIC assembly with chromatin remodeling that precedes and is required for transcription of eukaryotic genes. In this role, Mediator binds to the histone acetyltransferase p300 to promote chromatin acetylation, which in turn leads to dissociation of p300 from Mediator and DNA template, and allows TFIID to take its place in a complex with Mediator (60). A contrasting study in yeast suggests that Mediator is only required subsequent to chromatin remodeling during transcription of the CHA1 gene (61). Together with EM structural data, these findings support the idea that Mediator may serve as a platform to facilitate PIC assembly, possibly in coordination with chromatin remodeling. Mediator may regulate transcription in additional ways, through mechanisms such as direct regulation of the activities of pol II and general initiation factors, possibly even during elongation or splicing, but these remain to be investigated.

 

Specific contact with transcriptional activators is achieved by different Mediator subunits. Several forms of mammalian Mediator were identified in association with ligand-dependent nuclear receptors. These receptors, including the vitamin D receptor (VDR), retinoic acid receptor (RAR) α, retinoid X receptor (RXR) α (mutated in pinkie), peroxisome proliferation-activated receptor (PPAR) α, PPARγ, and estrogen receptors, bind specifically and directly to LXXLL motifs in the Mediator subunit Med1 (62-64), which is essential for mouse survival past embryonic day 11.5 (65;66). Med1-deficient embryos display hepatic necrosis, defects in hematopoiesis, hypoplasia of the ventricular myocardium, and impaired neuronal development with extensive apoptosis (65;66). Embryos die due to placental insufficiency (66). Med1 has been implicated in VDR- and RAR-mediated myelomonocytic differentiation and GATA-1-mediated erythropoiesis from hematopoietic progenitors  (67;68), and in PPARγ-dependent adipogenesis from fibroblasts (69;70). Although Med1 is essential for a wide range of physiological processes, the selective function of Med1 is supported by the observation that Med1-/- fibroblasts are impaired specifically in nuclear receptor-dependent pathways (65;70)

 

Other specific Mediator subunit interactions with transcriptional activators have been demonstrated. Med14 interacts with STAT2 in an interferon (IFN)-dependent manner upon coimmunoprecipitation, and enhances IFN-dependent transcription of a reporter gene in 293T cells (71). Med15 interacts with the Smad2- (or Smad3-) Smad4 complex in response to transforming growth factor (TGF)-β, Activin, or Nodal signaling to regulate axis formation and mesendoderm differentiation in Xenopus embryos in vivo (72). Med23 has been demonstrated to interact with adenovirus E1A and Elk1 (48;73;74), and Med25 (not present in yeast) with VP16 (75-77). A goal of Mediator research is to identify all subunit interactions with the diverse transcriptional activators present in mammalian cells, but whether gene-specific Mediator recruitment is mediated solely by subunit-activator contacts is still unknown.  Notably, EM studies have shown that Mediator complexes adopt different structures when bound by different transcriptional activators, even when they bind to the same subunit (15;78).

 

Yeast genetic studies using a temperature-sensitive mutant of the Med17 (yeast Srb4, an essential protein) subunit of Mediator demonstrated that transcription of all but two out of >5000 genes showed the same dependence on Srb4 as on the largest subunit of pol II, suggesting that Mediator is essential for transcription of all RNA pol II-dependent genes in yeast, and by extension, in all eukaryotes (79;80). Surprisingly, however, one study, using chromatin immunoprecipitation (ChIP) followed by microarray analysis, demonstrates that Mediator does not detectably associate with many highly active RNA pol II promoters in yeast cells (81). Moreover, in response to stress conditions, Mediator association is not directly correlated to RNA pol II association, and in some cases is not detectable at highly activated promoters. Thus, Mediator may not actually be required for transcription of all genes, or perhaps transient Mediator association is sufficient to activate transcription but goes undetected by ChIP.

 

The universal importance of Mediator is underscored by the fact that mice with targeted mutations in any of several Mediator subunits all die during embryogenesis before embryonic day 13.5. As mentioned above, Med1-/- mice die before embryonic day 11.5, and a Med1 hypomorphic mouse mutant dies before embryonic day 13.5 with a variety of developmental defects (65;66). Med21 is essential for survival past the blastocyst stage of mouse embryonic development (82)Med24-/- mice die before embryonic day 9.5 with anemia, cardiac hypoplasia (thin heart walls and poor trabeculation), vascular defects (narrow blood vessels), abnormal brain development (thin neural tube that fails to close), and poor plancental vasculature (83). Homozygous embryos harboring a gene trap insertion at the Cdk8 locus die due to defects in implantation at embryonic day 2.5 (84). Med12-deficient zebrafish embryos display defects in brain, neural crest, and kidney development, and do not survive beyond one week after fertilization (85). The phenotypes of Mediator subunit-deficient animals suggests a requirement for Mediator-dependent expression of many genes in multiple tissues, although not every Mediator subunit proves essential for cell viability per se.

 

In humans, missense mutations in MED12 cause Opitz-Kaveggia syndrome (OMIM #305450) and Lujan-Fryns syndrome (OMIM #309520). Opitz-Kaveggia syndrome (also called FG syndrome) is characterized by mental retardation, hypotonia, partial or complete loss of the corpus callosum, broad forehead, small, simple ears, imperforate anus, wide, flat thumbs, and wide big toes. Cardiac defects are also sometimes present. An arginine to tryptophan mutation at position 961 of the protein was detected in affected members of six families in which Opitz-Kaveggia syndrome was present (86). Individuals with the allelic disorder Lujan-Fryns syndrome have a tall stature, hypernasal voice, hyperextensible digits, and high nasal root. An asparagine to serine mutation at position 1007 of MED12 was identified in four affected members of a family with the disorder (87). Mutations of MED13L (also called PROSIT240) occur in patients with transposition of the great arteries (TGA), a congenital heart defect. MED13L was identified through physical mapping of the chromosomal translocation breakpoint in one affected individual (who also had mental retardation). The protein is 55% identical to MED13, but was not identified in any of the isolated mammalian Mediator complexes. Mutational screening of 97 additional patients with TGA revealed three missense mutations in MED13L, which were not detected in 400 control chromosomes (88).

 

Putative Mechanism

Figure 7.  Partial rescue of zeitgeist phenotype by KD. (A) Relative expression of selected genes at 23, 30, and 45 d of age as measured by quantitative PCR. Mice were fed either chow (CD; solid lines) or ketogenic (KD; dotted lines) diet beginning on day 23, when they were weaned. Gene expression in Med30zg/zg over that in Med30+/+ whole hearts is represented. For each biological sample, quantitative PCR reactions were performed in duplicate and expression was normalized to Rpl32 expression. For each indicated time point and diet, P values were determined by comparing the relative expression of the indicated gene in Med30zg/zg vs. Med30+/+ hearts using an unpaired Student's two-tailed t test. Statistically significant P values are indicated. For Med30zg/zg hearts, n = 3 for day 23 CD; n = 8 for day 30 CD; n = 5 for day 30 KD; n = 5 for day 45 KD. For Med30+/+ hearts, n = 2 for day 23 CD; n = 3 for day 30 CD; n = 5 for day 30 KD; n = 4 for day 45 KD. (B) Kaplan–Meier survival curve of Med30zg/zg mice (n = 3; ***P = 0.0002) on a KD compared with Med30zg/zg mice on a regular diet (n = 71). Significance was determined by log-rank test. ns, not significant.  Figure obtained from: (1).

During the development of the heart, there is a metabolic shift from fetal glucose and lactate oxidation to mitochondrial FAO, a process that relies on PGC-1 and ERR (estrogen-related receptor) (89;90).  A reduction of Ppargc1a and Esrra transcript expression, transcripts that encode PGC-1 and ERR, respectively, in LV of mutants with DCM together with the observation that the lifespan of homozygous mice can be extended using a ketogenic diet (KD) strongly suggests a role of Med30 in the regulation of metabolism as well as in the dietary change associated with weaning.  These changes in metabolism induced by the Med30 mutation lead to mitochondrial dysfunction and subsequent heart failure in the zeitgeist mice.

 

Newly weaned zeitgeist animals fed a KD had an increase in lifespan.  In addition, the cardiac expression of Ppargc1a, Esrra, Sod2 and other OXPHOS gens was increased in the KD-fed zeitgeist mice as compared to the chow-fed controls (Figure 7).  It appears that KD can counterbalance the detrimental effects of the zeitgeist mutation by stimulating, albeit through unknown mechanisms, the expression of OXPHOS genes (1).

Genotyping
Zeitgeist genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
zeitgeist (F): 5’- TGAGAAAGAATGCTCTGCAAGAACCC -3’
zeitgeist (R): 5’-GTAACCCTGAGCAAGAGATAGATGCAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
zeitgeist_seq(F): 5’- GGGCAGAACTCTACTTCTGATTG -3’
zeitgeist_seq(R): 5’- TTTCCAGGGCGTGAGACAG -3’
 
The following sequence of 785 nucleotides (from Genbank genomic region NC_000081, Chromosome 15, bases 5255956 to 5256740) is amplified:
 
                tgaga aagaatgctc tgcaagaacc caacagaagc agagaaccag
ccagacacac aacttagggc acagacagaa ctctgggaaa gcccacccca tctatcactg
gtaccgcccc ctgggcagaa ctctacttct gattgggtaa tttcctgtct gtcttaccgt
tcccaactgc ggagcccaat cgcgtcaggc tccgcgaggc gccagtcttc cggtacagcg
cttgcatcgc ggcgggcgga agtggcgccg cttttttgaa atcggccgag tgggctcgcg
ccggacccga gccgccgggg gtgccatgtc cacccctccg ctggcgccca cgggcatggc
gtccgggccc ttcggcggcc cgcaggctca gcaggccgcg cgcgaggtca acacggccac
gctgtgccgc atcgggcagg agaccgtgca ggacatcgtg taccgcacca tggagatctt
ccagctgctc aggaacatgc aggtgggcgc ctggggtgac agagctggtg aaagcgggcc
tccgcgggcg acctcagggt ggccgggtcg cctctacacc ccaggtcctc agcgtgtatc
cccttgccct gagaggccgc aggtgtggag gtcccacctc ctccttaccc catacctgga
agacctcagg ctggccatcc tgctttacac ccttggttcc cagtatgtgt ctgtctcacg
ccctggaaaa ccctcaggca tggacacacc cccttatacc caaagtcccc accgtgcatc
tatctcttgc tcagggttac
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.
References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine
AuthorsPhilippe Krebs, Bruce Beutler