Phenotypic Mutation 'patch' (pdf version)
Allelepatch
Mutation Type nonsense
Chromosome13
Coordinate64,366,623 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Ctsl
Gene Name cathepsin L
Synonym(s) major excreted protein, 1190035F06Rik, Cat L, MEP
Chromosomal Location 64,359,337-64,370,890 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the activation peptide and the cathepsin L1 heavy and light chains. The mature enzyme appears to be important in embryonic development through its processing of histone H3 and may play a role in disease progression in a model of kidney disease. Homozygous knockout mice for this gene exhibit hair loss, skin thickening, bone and heart defects, and enhanced susceptibility to bacterial infection. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for mutant alleles may show partial or complete hair-loss, skin defects, impaired T cell maturation, dilated cardiomyopathy, and high postnatal mortality. Mutant males for some alleles show both normal and atrophic seminiferous tubules and reduced sperm production. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009984; MGI:88564

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021933] [ENSMUSP00000152551] [ENSMUSP00000152497] [ENSMUSP00000152169] [ENSMUSP00000152357]
PDB Structure
[]
SMART Domains Protein: ENSMUSP00000021933
Gene: ENSMUSG00000021477
AA Change: R214*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.98e-23 SMART
Pept_C1 114 332 1.67e-128 SMART
Predicted Effect probably null
Predicted Effect probably benign
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably benign
Meta Mutation Damage Score 0.9704 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD8+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS T cells - decreased
Candidate Explorer Status CE: good candidate; human score: -1; ML prob: 0.66
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (other)(1) Gene trapped(4) Radiation induced(1) Spontaneous(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ctsl APN 13 64368168 missense probably damaging 1.00
IGL02895:Ctsl APN 13 64366512 missense probably damaging 0.97
mauvais UTSW 13 64364102 unclassified probably null
R0518:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R0521:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R1546:Ctsl UTSW 13 64367879 missense probably damaging 1.00
R2096:Ctsl UTSW 13 64369026 critical splice donor site probably null
R5690:Ctsl UTSW 13 64365208 missense probably damaging 1.00
R5804:Ctsl UTSW 13 64366488 missense probably damaging 1.00
R6182:Ctsl UTSW 13 64367972 missense probably damaging 0.99
R6670:Ctsl UTSW 13 64364102 unclassified probably null
R6725:Ctsl UTSW 13 64366623 nonsense probably null
R6886:Ctsl UTSW 13 64365147 utr 3 prime probably null
R7502:Ctsl UTSW 13 64367068 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2019-11-12 12:11 PM by Thomas Gallagher
Record Created 2019-02-08 12:20 PM by Jamie Russell
Record Posted 2019-03-15
Phenotypic Description
Figure 1. Patch mice show variable alopecia and sparse hair growth.
Figure 2. Patch mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Patch mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Patch mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Patch mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Patch mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Patch mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Patch mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Patch mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Patch mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Patch mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Patch mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Patch mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Patch mice exhibit increased CD44 expression on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Patch mice exhibit increased CD44 expression on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Patch mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The patch phenotype was identified among G3 mice of the pedigree R6725, some of which showed sparse hair growth and/or alopecia all over their bodies (Figure 1). Some mice also showed decreased CD4 to CD8 T cell ratios (Figure 2), and reduced frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), CD4+ T cells in CD3+ T cells (Figure 5), and naïve CD4 T cells in CD4 T cells (Figure 6) with concomitant increased frequencies of CD44+ T cells (Figure 7), CD44+ CD8 T cells (Figure 8), CD8+ T cells (Figure 9), CD8+ T cells in CD3+ T cells (Figure 10), central memory CD4 T cells in CD4 T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), and effector memory CD4 T cells in CD4 T cells (Figure 13), all in the peripheral blood. The mice showed increased CD44 expression on peripheral blood T cells (Figure 14), CD4+ T cells (Figure 15), and CD8+ T cells (Figure 16).

Nature of Mutation

Figure 17. Linkage mapping of the reduced CD4+ T cell frequency phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R6725. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. The hair growth phenotype was linked to a mutation in Ctsl:  an A to T transversion at base pair 64,366,623 (v38) on chromosome 13, or base pair 4,126 in the GenBank genomic region NC_000079. The strongest association was found with a recessive model of inheritance to the reduced CD4+ T cell in CD3+ T cell frequency phenotype, wherein 18 variant homozygotes departed phenotypically from 19 homozygous reference mice and 39 heterozygous mice with a P value of 7.975 x 10-32 (Figure 17). A substantial semidominant effect was also observed for most of the assays, but the mutation is preponderantly recessive. 

 

The mutation corresponds to residue 936 in the mRNA sequence NM_009984 within exon 6 of 8 total exons.

 

921 GGATCTTGTAAATACAGAGCCGAGTTCGCTGTG

209 -G--S--C--K--Y--R--A--E--F--A--V-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine (R) 214 for a premature stop codon (R214*) in the CTSL protein.

Protein Prediction
Figure 18. Domain organization of cathepsin L. Cathepsin L does not have defined domains, but is comprised of a signal peptide (SP), propeptide, heavy chain and a light chain. The patch mutation results in substitution of arginine 214 for a premature stop codon. This image is interactive. Other mutations found in the protein are noted in red. Click on each allele for more information. Abberviations: SP, signal peptide. 
Figure 19. Crystal structure of human procathepsin L. The α helices are shown in pink, and β strands are shown in cyan. UCSF Chimera model is based on PDB 1CJL, Coulombe et al. EMBO J. 15,5492-5503 (1996). Click on the 3D structure to view it rotate.

Ctsl encodes cathepsin L, one of 11 cysteine protease cathepsins (i.e., cathepsins B, C, F, H, K, L, O, S (see the record for clip, V, W, and X). The cysteine cathepsins are members of the papain family.

 

Human liver cathepin L is comprised of a 25-kDa heavy chain and a 5-kDa light chain (Figure 18) (1). Cathepsin L has a 17-amino acid signal sequence and a 96-amino acid propeptide that is not present in the heavy chain in the mature protein (2,3). Procathepsin L is processed to mature cathepsin L through cleavage of the propeptide in the lysosome (4).

 

Cathepsin L folds similar to other members of the papain superfamily [Figure 19; PDB:1CJL; (5)]. Cathepsin L has two domains delimiting an active-site cleft containing the catalytic Cys25 and His163 residues; Cys25 is within the mostly α-helical domain, while His163 is within the mostly β-sheet domain. The propeptide region of cathepsin L has three segments: a globular domain, an active cleft-binding segment, and a flexible C-terminal segment (5). The globular domain is comprised of the intersecting α (α1 and α2) helices and the β1 strand. The β1 strand, running antiparallel to the α2 helix, interacts with the proregion binding loop of the mature enzyme. The proregion is required for proper protein folding, stability, and for exit from the endoplasmic reticulum (6). The proregion contacts cathepsin L along the substrate binding cleft and along the surface formed by the His140—Asp155 loop (5). Cathepsin L has a conserved α-helical motif (ER(F/W)N(I/V)N) within the α2 helix of the proregion that is essential for its proper folding, transport, and maturation (7). The C-terminus of cathepsin L is required for its secretion, but not for its enzyme activity, posttranslational processing, or subcellular distribution (8). Serine, proline, and valine residues within the last six amino acids of the C-terminal tail are required for cathepsin L secretion.

 

Human CTSL produces two mRNAs (CATLA and CATLB) that differ in the 5’-UTR (9). The two mRNAs are putatively generated through the use of alternative splicing or the presence of a second promoter within the first intron of CTSL. The functional significance of the two mRNAs is unknown. CATLB was expressed at higher levels than CATLA in all human cell lines examined. A second study cloned three CTSL variants: CATLA, CATLA2, and CATLA3; the CATLB variant could not be cloned (10). The CATLA, CATLA2, and CATLA3 variants differed in the length of exon 1. The CATLA3 variant was predominantly expressed in all tissues and cells examined. A third study found four splice variants (CATLA, CATLA1, CATLA2, and CATLA3) in several human tumor cell lines (11). All variants had identical open reading frames, but differed in the 5’-UTR. A fourth study found two human CTSL splice variants designated CATL-A I and CATL-A II, which lack 27-base pairs and 90-base pairs from exon 1, respectively (12). The splice variants do not affect the translated product.

 

The patch mutation results in substitution of arginine (R) 214 for a premature stop codon (R214*); residue 214 is within the cathepsin L heavy chain; the mutation is predicted to affect both the heavy and light chains.

Expression/Localization

Cathepsin L is ubiquitously expressed. In rats, cathepsin L is highly expressed in the kidney, with lower expression in the liver, spleen, lungs, brain and cerebellar cortex, and low expression in the heart, skeletal muscle, gastrointestinal tract, and peripheral blood cells (13).

Background

Cathepsin L is a cysteine protease. A cysteine protease hydrolyses a peptide bond using the thiol group of a cysteine residue as a nucleophile. Hydrolysis involves usually a catalytic triad consisting of the thiol group of the cysteine, the imidazolium ring of a histidine, and a third residue, usually asparagine or aspartic acid, to orientate and activate the imidazolium ring. 

 

Cathepsin L promotes the cleavage of several target proteins (Table 1), functioning in numerous physiological and pathological processes, including thyroid hormone processing, arthritis, osteoporosis, bone resorption, and cancer. Cathepsin L is essential for matrix degradation, invasion of circulating endothelial progenitor cells into ischemic tissue, and endothelial progenitor cell-mediated neovascularization (14).

 

Table 1. Select cathepsin L targets

Target

Brief Description of Target

Downstream effect of cathepsin L-associated cleavage of target

References

Invariant light chain

Chaperone of the MHC II receptor which guides it to the lysosome

Cleavage is necessary for antigen loading and proper CD4 T cell development

(15,16)

Dynamin

GTPase that functions in clathrin-dependent endocytosis and vesicle trafficking

Cleavage results in podocyte actin cytoskeleton reorganization and proteinuria  during proteinuric kidney disease

(17)

Retinoid X receptor a (RXRa)

Nuclear receptor that binds target genes, regulating their transcription

Unknown

(18)

Gastric intrinsic factor

Glycoprotein required for absorption of vitamin B12 in the small intestine

Unknown

(19)

Articular-cartilage proteoglycan aggregates

Maintain the properties of the cartilage extracellular matrix

Unknown

(20)

Alpha 1-proteinase inhibitor

Antiprotease in human plasma

Inactivates alpha 1-proteinase inhibitor, putatively regulating processing of neutrophil elastase in the lung

(21)

Elastin

Extracellular matrix protein that promotes elasticity in many tissues

Unknown

(22)

Fructose-1,6-bisphosphate aldolase

Enzyme in glycolysis and gluconeogenesis that catalyzes the reversible cleavage of fructose-1,6-bisphosphate into dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (GAP)

Inactivates fructose-1,6-bisphosphate aldolase

(23)

Collagen

Abundant component of connective tissues

Loss of collagen activity; release proteolytic fragments from insoluble collagen

(24,25)

Glucagon

Hormone that controls blood glucose levels

Mature protein generation from precursor protein

(26)

Insulin-like growth factor binding protein-3 (IGFBP-3)

Binds insulin growth factors, modulating their effects

Releases IGFs from their IGFBP complexes 

(27)

Insulin-like growth factor-1 receptor (IGF-1R)

Receptor activated by insulin-like growth factor 1 (IGF-1) and IGF-2

Pre-adipocyte adipogenesis and regulation of glucose uptake

(28)

Insulin receptor

Activated by insulin, IGF-1, and IGF-2 (see the record for gummi_bear)

Fibronectin

Extracellular matrix protein that binds integrins, collagen, fibrin, and heparan sulfate proteoglycans

Fibronectin degradation

Progranulin

Granulin precursor protein

Cleavage into intermediate poly-granulin and mature granulin fragments

(29)

α-synuclein

Presynaptic neuronal protein; aggregation and dysfunction is often observed in neurodegenerative disorders

Promotes degradation of α-synuclein amyloid fibrils and subsequent clearance of aggregated α-synuclein

(30)

Amyloid precursor protein C-terminal fragments

Contains the amyloid β (Aβ) peptide, which is linked to Alzheimer’s disease

Protein degradation and/or processing

(31)

Histone H3

Protein involved in the structure of chromatin

Putatively mouse embryonic stem cell development or differentiation

(32,33)

CDP/Cux (CCAAT-displacement protein/Cut homeobox)

Transcription factor that functions as either a repressor activator

Processing of the transcription factor in the nucleus, putatively functioning in the control of the cell cycle

(34)

Proenkephalin

Opioid polypeptide hormone

Processing of proenkephalin into mature (Met)enkephalin

(35,36)

Neuropeptide Y

Orexigenic neuropeptide

Processing of propeptide to produce mature peptide

(37)

Proopiomelanocortin (POMC)

Adrenocorticotrophic hormone

 

Biosynthesis of the pituitary hormones ACTH, β-endorphin, and α-MSH from POMC

(38)

E-cadherin

Cell adhesion molecule essential for the formation of adherens junctions

Cancer invasion and metastasis

(39)

L-lactate dehydrogenase

Enzyme that catalyzes the reversible conversion of lactate to pyruvate 

 

Inactivation and degradation

(40)

 

In humans, cathepsin L is linked to myofibril necrosis in myopathies and in myocardial ischemia, and in the renal tubular response to proteinuria (2). Cathepsin L activity is elevated in chronic kidney disease patients, indicating that serum levels of cathepsin L may be a biomarker for the disease (41). Cathepsin L and cathepsin B activity is also increased in peripheral blood mononuclear cells from patients with dilated cardiomyopathy (42). Increased levels of both cathepsin L and cathepsin B correlated with reduced left ventricular ejection fraction in the patients.

 

Thymocytes develop into T cells in the thymus through interactions with cortical thymic epithelial cells (cTECs). CD4+/CD8+ double positive thymocytes undergo both positive and negative selection based on the strength of the interaction between the T cell receptor (TCR) and the major histocompatibility complex (MHC) of cTECs. If the interaction is too weak, T cells undergo death by neglect and if the interaction is too strong, T cells undergo negative selection. Interactions in a narrow range of affinities lead to positive selection and survival of the thymocytes (43–45). The strength of this interaction is determined by the antigens loaded on the MHCs.

cTECs express cathepsin L (Ctsl) and undergo a high rate of constitutive macroautophagy (46). Macroautophagy is carried out by cathepsin L and the thymus-specific serine protease Prss16 to generate self-peptides which are loaded onto MHC II receptors (47–50). MHC I complexes undergo a similar antigen loading process where peptides are generated by the proteasome β5t (Psmb11) (51).

MHC II receptors are αβ heterodimers which are assembled with the assistance of the invariant (Ii) chain. The Ii chain functions as a chaperone and is crucial for targeting the MHC II receptor to the lysosome, where the Ii chain is degraded by cathepsin L and antigens are loaded onto the MHC II receptor before it is transported to the plasma membrane to interact with TCRs (15,16).

Putative Mechanism
Figure 20. Hair follicle and cycle. (A) The hair follicle consists of eight epithelial layers including the outer root sheath, companion layer, inner root sheath (consisting of Henle’s, Huxley’s and cuticle layers) and the hair shaft (consisting of cuticle, cortex and medulla).  All layers, with the exception of the outer root sheath, are derived from proliferative cells of the hair matrix, located around the dermal papilla at the base of the hair bulb.  (B) After hair follicles are established, hair is periodically shed and replaced, involving periodic destruction and regeneration of hair follicles. The hair cycle is divided into three periods: Anagen Phase (follicle growth), Catagen Phase (regression), and Telogen Phase (rest). Several signaling pathways are implicated in hair follicle regeneration. Mutations that affect the indicated stages of the cycle are noted in red text. Genes affected by these mutations are noted in black, italic text. Click each allele for more specific information.

Mice homozygous for null alleles exhibited alopecia, short hair length, dull greasy coats, short and sparse vibrissae, increased keratinocyte proliferation, aberrant hair cycling, epidermal hyperplasia, thick epidermis, reduced CD4T cell numbers, increased regulatory T cell numbers, reduced NK T cells, reduced osteoclast numbers, dermatitis, folliculitis, disorganized mineralized cartilage zone, and reduced amounts of trabecular bone (52–56). Some Ctsl-deficient mice showed reduced viability before weaning, enlarged hearts, cardiac interstitial fibrosis, dilated cardiomyopathy, increased heart rates, prolonged intervals between the R- and T-waves of an electrocardiogram, and increased thyroglobulin levels (57–60). Mice homozygous for a spontaneous single-point mutation (Ctslfs/fs; p.R149G) showed reduced viability before weaning as well as alopecia and absent vibrissae (61,62). Although fertile, some male Ctslfs/fs mice showed reduced testis weights, atrophic seminiferous tubules, reduced formation of preloptotene spermatocytes in normal tubules, and reduced differentiation of preloptotene spermatocytes into pachytene spermatocytes in normal tubules (63). Mice homozygous for a radiation-induced 118-base pair deletion in exons 6 and 7 (Ctslnkt/nkt) showed runting, delayed hair appearance, aberrant hair follicle development, sparse hair, alopecia, epidermal hyperplasia, excessive scratching, dermatitis, skin lesions, enlarged sebaceous glands, enlarged lymph nodes, enlarged thymus cortex, corneal opacity, areas of periodontal ligament and dental pulp necrosis, reduced numbers of CD4+ T cells with concomitant increased numbers of CD8+ T cells (64–67). Ctslnkt/nkt pups suckled by either a heterozygous or homozygous dam showed lethality by 3 weeks or 10 days, respectively (64).

 

Cathepsin L is required for proper hair follicle morphogenesis and cycling as well as for proper epidermal differentiation (Figure 20) (56,66). Ctsl-deficient mice showed disruption in the exiting of hair shafts to the skin surface primarily due to a failure of the inner root sheath to fully desquamate, dilation of the hair canal, and abnormal routing of sebaceous gland products to the skin surface (56).

 

The hair loss phenotype observed in the patch mice indicates loss of cathepsin-associated function.

 

Mice lacking Ctsl have been reported to have severely impaired CD4+ T cell populations (47,65,68). This has been demonstrated to be through both failure to degrade the Ii chain and an inability to generate self-peptides (46–50). MHC II receptors are then unable to bind TCRs, leading to reduced positive selection and causing thymocytes to undergo excessive death by neglect (69–71).

 

No phenotypic mutations are listed in the Mutagenetix database for Prss16, Psmb5, Psmb8, or Psmb11.

Primers PCR Primer
patch_pcr_F: CAAAGTCAGGGAGGTGCTAATTC
patch_pcr_R: GGCTTTGTTTTCAGAAAAGGAAGC

Sequencing Primer
patch_seq_F: GGAGGTGCTAATTCTGACCATTACC
patch_seq_R: CCAGATGTGGTTTTCAGAGTTCATAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 401 nucleotides is amplified (chromosome 13, - strand):

 

 

1   ggctttgttt tcagaaaagg aagcattacc agatgtggtt ttcagagttc atactttagt
61  gggtaactca cagcattcta gttcaaggga tggtttctga gtattggcct cacacggcgt
121 gagctgcaag tcactgtttt gtttctagag ctcatgttct aagaggtaaa cagttgtgat
181 caagtctccc ccttaacttt caaaggacgg atcttgtaaa tacagagccg agttcgctgt
241 ggctaatgac acagggttcg tggatatccc tcagcaagag aaagccctca tgaaggctgt
301 ggcgactgtg gggcctattt ctgttgctat ggacgcaagc catccgtctc tccagttcta
361 tagttcaggt aatggtcaga attagcacct ccctgacttt g

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1.         Mason RW, Walker JE, Northrop FD. The N-terminal amino acid sequences of the heavy and light chains of human cathepsin L Relationship to a cDNA clone for a major cysteine proteinase from a mouse macrophage cell line. Biochemical Journal. 1986 Dec 1;240(2):373–7.

2.         Joseph LJ, Chang LC, Stamenkovich D, Sukhatme VP. Complete nucleotide and deduced amino acid sequences of human and murine preprocathepsin L. An abundant transcript induced by transformation of fibroblasts. J Clin Invest. 1988 May 1;81(5):1621–9.

3.         Wiederanders B, Kirschke H. The processing of a cathepsin L precursor in vitro. Archives of Biochemistry and Biophysics. 1989 Aug 1;272(2):516–21.

4.         Ishidoh K, Saido TC, Kawashima S, Hirose M, Watanabe S, Sato N, et al. Multiple Processing of Procathepsin L to Cathepsin Lin Vivo. Biochemical and Biophysical Research Communications. 1998 Nov 9;252(1):202–7.

5.         Coulombe R, Grochulski P, Sivaraman J, Ménard R, Mort JS, Cygler M. Structure of human procathepsin L reveals the molecular basis of inhibition by the prosegment. The EMBO Journal. 1996 Oct 1;15(20):5492–503.

6.         Tao K, Stearns NA, Dong JM, Wu QI, Sahagian GG. The Proregion of Cathepsin L Is Required for Proper Folding, Stability, and ER Exit. Archives of Biochemistry and Biophysics. 1994 May 1;311(1):19–27.

7.         Kreusch S, Fehn M, Maubach G, Nissler K, Rommerskirch W, Schilling K, et al. An evolutionarily conserved tripartite tryptophan motif stabilizes the prodomains of cathepsin L-like cysteine proteases. European Journal of Biochemistry. 2000 May 1;267(10):2965–72.

8.         Chauhan SS, Ray D, Kane SE, Willingham MC, Gottesman MM. Involvement of Carboxy-Terminal Amino Acids in Secretion of Human Lysosomal Protease Cathepsin L. Biochemistry. 1998 Jun 1;37(23):8584–94.

9.         Chauhan SS, Popescu NC, Ray D, Fleischmann R, Gottesman MM, Troen BR. Cloning, genomic organization, and chromosomal localization of human cathepsin L. Journal of Biological Chemistry. 1993 Jan 15;268(2):1039–45.

10.       Abudula Abulizi, Rommerskirch Winfried, Weber Ekkehard, Günther Dagmar, Wiederanders Bernd. Splice Variants of Human Cathepsin L mRNA Show Different Expression Rates. bchm. 2005;382(11):1583.

11.       Arora S, Chauhan SS. Identification and characterization of a novel human cathepsin L splice variant. Gene. 2002 Jun 26;293(1):123–31.

12.       Rescheleit DK, Rommerskirch WJ, Wiederanders B. Sequence analysis and distribution of two new human cathepsin L splice variants. FEBS Letters. 1996 Oct 7;394(3):345–8.

13.       Bando Y, Kominami E, Katunuma N. Purification and Tissue Distribution of Rat Cathepsin L1. The Journal of Biochemistry. 1986 Jul 1;100(1):35–42.

14.       Urbich C, Heeschen C, Aicher A, Sasaki K, Bruhl T, Farhadi MR, et al. Cathepsin L is required for endothelial progenitor cell–induced neovascularization. Nature Medicine. 2005 Feb 1;11(2):206–13.

15.       Sant AJ, Miller J. MHC class II antigen processing: biology of invariant chain. Current Opinion in Immunology. 1994 Feb 1;6(1):57–63.

16.       Cresswell P. Invariant Chain Structure and MHC Class II Function. Cell. 1996 Feb 23;84(4):505–7.

17.       Sever S, Altintas MM, Nankoe SR, Möller CC, Ko D, Wei C, et al. Proteolytic processing of dynamin by cytoplasmic cathepsin L is a mechanism for proteinuric kidney disease. J Clin Invest. 2007 Aug 1;117(8):2095–104.

18.       Nomura Y, Nagaya T, Yamaguchi S, Katunuma N, Seo H. Cleavage of RXRα by a Lysosomal Enzyme, Cathepsin L-type Protease. Biochemical and Biophysical Research Communications. 1999 Jan 19;254(2):388–94.

19.       Gordon MM, Howard T, Becich MJ, Alpers DH. Cathepsin L mediates intracellular ileal digestion of gastric intrinsic factor. American Journal of Physiology-Gastrointestinal and Liver Physiology. 1995 Jan 1;268(1):G33–40.

20.       Nguyen Q, Mort JS, Roughley PJ. Cartilage proteoglycan aggregate is degraded more extensively by cathepsin L than by cathepsin B. Biochem J. 1990 Mar 1;266(2):569–73.

21.       Johnson DA, Barrett AJ, Mason RW. Cathepsin L inactivates alpha 1-proteinase inhibitor by cleavage in the reactive site region. Journal of Biological Chemistry. 1986 Nov 5;261(31):14748–51.

22.       Mason RW, Johnson DA, Barrett AJ, Chapman HA. Elastinolytic activity of human cathepsin L. Biochemical Journal. 1986 Feb 1;233(3):925–7.

23.       McKay MJ, Marsh MW, Kirschke H, Bond JS. Inactivation of fructose-1,6-bisphosphate aldolase by cathepsin L stimulation by ATP. Biochimica et Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology. 1984 Jan 18;784(1):9–15.

24.       Kirschke H, Kembhavi AA, Bohley P, Barrett AJ. Action of rat liver cathepsin L on collagen and other substrates. Biochem J. 1982 Feb 1;201(2):367–72.

25.       Korenč M, Lenarčič B, Novinec M. Human cathepsin L, a papain-like collagenase without proline specificity. The FEBS Journal. 2015 Nov 1;282(22):4328–40.

26.       Kärgel H, Dettmer R, Etzold G, Kirschke H, Bohley P, Langner J. Action of rat liver cathepsin L on glucagon. Acta biologica et medica Germanica. 1981;40(9):1139–43.

27.       Zwad O, Kübler B, Roth W, Scharf J-G, Saftig P, Peters C, et al. Decreased intracellular degradation of insulin-like growth factor binding protein-3 in cathepsin L-deficient fibroblasts. FEBS Letters. 2002 Jan 16;510(3):211–5.

28.       Yang M, Zhang Y, Pan J, Sun J, Liu J, Libby P, et al. Cathepsin L activity controls adipogenesis and glucose tolerance. Nature Cell Biology. 2007 Aug 1;9(8):970–7.

29.       Lee CW, Stankowski JN, Chew J, Cook CN, Lam Y-W, Almeida S, et al. The lysosomal protein cathepsin L is a progranulin protease. Molecular Neurodegeneration. 2017 Jul 25;12(1):55.

30.       McGlinchey RP, Dominah GA, Lee JC. Taking a Bite Out of Amyloid: Mechanistic Insights into α-Synuclein Degradation by Cathepsin L. Biochemistry. 2017 Aug 1;56(30):3881–4.

31.       Wang H, Sang N, Zhang C, Raghupathi R, Tanzi RE, Saunders A. Cathepsin L Mediates the Degradation of Novel APP C-Terminal Fragments. Biochemistry. 2015 May 12;54(18):2806–16.

32.       Duncan EM, Muratore-Schroeder TL, Cook RG, Garcia BA, Shabanowitz J, Hunt DF, et al. Cathepsin L Proteolytically Processes Histone H3 During Mouse Embryonic Stem Cell Differentiation. Cell. 2008 Oct 17;135(2):284–94.

33.       Adams-Cioaba MA, Krupa JC, Xu C, Mort JS, Min J. Structural basis for the recognition and cleavage of histone H3 by cathepsin L. Nature Communications. 2011 Feb 15;2(1):197.

34.       Goulet B, Baruch A, Moon N-S, Poirier M, Sansregret LL, Erickson A, et al. A Cathepsin L Isoform that Is Devoid of a Signal Peptide Localizes to the Nucleus in S Phase and Processes the CDP/Cux Transcription Factor. Molecular Cell. 2004 Apr 23;14(2):207–19.

35.       Funkelstein L, Beinfeld M, Minokadeh A, Zadina J, Hook V. Unique biological function of cathepsin L in secretory vesicles for biosynthesis of neuropeptides. Neuropeptides. 2010 Dec 1;44(6):457–66.

36.       Hwang S-R, Garza C, Mosier C, Toneff T, Wunderlich E, Goldsmith P, et al. Cathepsin L Expression Is Directed to Secretory Vesicles for Enkephalin Neuropeptide Biosynthesis and Secretion. Journal of Biological Chemistry. 2007 Mar 30;282(13):9556–63.

37.       Funkelstein L, Toneff T, Hwang S-R, Reinheckel T, Peters C, Hook V. Cathepsin L participates in the production of neuropeptide Y in secretory vesicles, demonstrated by protease gene knockout and expression. Journal of Neurochemistry. 2008 Jul 1;106(1):384–91.

38.       Funkelstein L, Toneff T, Mosier C, Hwang S-R, Beuschlein F, Lichtenauer UD, et al. Major Role of Cathepsin L for Producing the Peptide Hormones ACTH, β-Endorphin, and α-MSH, Illustrated by Protease Gene Knockout and Expression. Journal of Biological Chemistry. 2008 Dec 19;283(51):35652–9.

39.       Gocheva V, Zeng W, Ke D, Klimstra D, Reinheckel T, Peters C, et al. Distinct roles for cysteine cathepsin genes in multistage tumorigenesis. Genes & Development. 2006 Mar 1;20(5):543–56.

40.       Ohshima J, Lee Y, Sasai M, Saitoh T, Su Ma J, Kamiyama N, et al. Role of Mouse and Human Autophagy Proteins in IFN-γ–Induced Cell-Autonomous Responses against Toxoplasma gondii. J Immunol. 2014 Apr 1;192(7):3328.

41.       Cao Y, Liu X, Li Y, Lu Y, Zhong H, Jiang W, et al. Cathepsin L activity correlates with proteinuria in chronic kidney disease in humans. International Urology and Nephrology. 2017 Aug 1;49(8):1409–17.

42.       Mehra S, Kumar M, Manchanda M, Singh R, Thakur B, Rani N, et al. Clinical significance of cathepsin L and cathepsin B in dilated cardiomyopathy. Molecular and Cellular Biochemistry. 2017 Apr 1;428(1):139–47.

43.       Hernandez JB, Newton RH, Walsh CM. Life and death in the thymus—cell death signaling during T cell development. Current Opinion in Cell Biology. 2010 Dec 1;22(6):865–71.

44.       Starr TK, Jameson SC, Hogquist KA. Positive and Negative Selection of T Cells. Annu Rev Immunol. 2003 Apr 1;21(1):139–76.

45.       Kyewski B, Klein L. A Central Role for Central Tolerance. Annu Rev Immunol. 2006 Mar 21;24(1):571–606.

46.       Nedjic J, Aichinger M, Mizushima N, Klein L. Macroautophagy, endogenous MHC II loading and T cell selection: the benefits of breaking the rules. Current Opinion in Immunology. 2009 Feb 1;21(1):92–7.

47.       Nakagawa T, Roth W, Wong P, Nelson A, Farr A, Deussing J, et al. Cathepsin L: Critical Role in Ii Degradation and CD4 T Cell Selection in the Thymus. Science. 1998 Apr 17;280(5362):450.

48.       Honey K, Nakagawa T, Peters C, Rudensky A. Cathepsin L Regulates CD4+ T Cell Selection Independently of Its Effect on Invariant Chain. J Exp Med. 2002 May 20;195(10):1349.

49.       Gommeaux J, Grégoire C, Nguessan P, Richelme M, Malissen M, Guerder S, et al. Thymus-specific serine protease regulates positive selection of a subset of CD4+ thymocytes. European Journal of Immunology. 2009 Apr 1;39(4):956–64.

50.       Hsieh C-S, deRoos P, Honey K, Beers C, Rudensky AY. A Role for Cathepsin L and Cathepsin S in Peptide Generation for MHC Class II Presentation. J Immunol. 2002 Mar 15;168(6):2618.

51.       Murata S, Sasaki K, Kishimoto T, Niwa S, Hayashi H, Takahama Y, et al. Regulation of CD8+ T Cell Development by Thymus-Specific Proteasomes. Science. 2007 Jun 1;316(5829):1349.

52.       Tholen M, Hillebrand LE, Tholen S, Sedelmeier O, Arnold SJ, Reinheckel T. Out-of-frame start codons prevent translation of truncated nucleo-cytosolic cathepsin L in vivo. Nature Communications. 2014 Sep 15;5(1):4931.

53.       Potts W, Bowyer J, Jones H, Tucker D, Freemont AJ, Millest A, et al. Cathepsin L-deficient mice exhibit abnormal skin and bone development and show increased resistance to osteoporosis following ovariectomy. International Journal of Experimental Pathology. 2004 Apr 1;85(2):85–96.

54.       Hsing LC, Kirk EA, McMillen TS, Hsiao S-H, Caldwell M, Houston B, et al. Roles for cathepsins S, L, and B in insulitis and diabetes in the NOD mouse. Journal of Autoimmunity. 2010 Mar 1;34(2):96–104.

55.       Honey K, Benlagha K, Beers C, Forbush K, Teyton L, Kleijmeer MJ, et al. Thymocyte expression of cathepsin L is essential for NKT cell development. Nature Immunology. 2002 Nov 1;3(11):1069–74.

56.       Tobin DJ, Foitzik K, Reinheckel T, Mecklenburg L, Botchkarev VA, Peters C, et al. The Lysosomal Protease Cathepsin L Is an Important Regulator of Keratinocyte and Melanocyte Differentiation During Hair Follicle Morphogenesis and Cycling. The American Journal of Pathology. 2002 May 1;160(5):1807–21.

57.       Stypmann J, Gläser K, Roth W, Tobin DJ, Petermann I, Matthias R, et al. Dilated cardiomyopathy in mice deficient for the lysosomal cysteine peptidase cathepsin L. Proc Natl Acad Sci USA. 2002 Apr 30;99(9):6234.

58.       Roth W, Deussing J, Botchkarev VA, Pauly-Evers M, Saftig P, Hafner A, et al. Cathepsin L deficiency as molecular defect of furless: hyperproliferation of keratinocytes and pertubation of hair follicle cycling. The FASEB Journal. 2000 Oct 1;14(13):2075–86.

59.       Friedrichs B, Tepel C, Reinheckel T, Deussing J, von Figura K, Herzog V, et al. Thyroid functions of mouse cathepsins B, K, and L. J Clin Invest. 2003 Jun 1;111(11):1733–45.

60.       Petermann I, Mayer C, Stypmann J, Biniossek ML, Tobin DJ, Engelen MA, et al. Lysosomal, cytoskeletal, and metabolic alterations in cardiomyopathy of cathepsin L knockout mice. The FASEB Journal. 2006 Apr 24;20(8):1266–8.

61.       Green EL. The Genetics of a New Hair Deficiency, Furless: In the House Mouse. Journal of Heredity. 1954 May 1;45(3):115–8.

62.       Green EL. Fitness of heterozygotes of deleterious recessive mutations in the mouse. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis. 1971 Jul 1;12(3):281–9.

63.       Wright WW, Smith L, Kerr C, Charron M. Mice That Express Enzymatically Inactive Cathepsin L Exhibit Abnormal Spermatogenesis1. Biology of Reproduction. 2003 Feb 1;68(2):680–7.

64.       Benavides F, Giordano M, Fiette L, Bueno Brunialti AL, Martin Palenzuela N, Vanzulli S, et al. Nackt (nkt), a new hair loss mutation of the mouse with associated CD4 deficiency. Immunogenetics. 1999 Apr 1;49(5):413–9.

65.       Benavides F, Venables A, Poetschke Klug H, Glasscock E, Rudensky A, Gómez M, et al. The CD4 T cell-deficient mouse mutation nackt (nkt) involves a deletion in the cathepsin L (Ctsl) gene. Immunogenetics. 2001 Apr 1;53(3):233–42.

66.       Benavides F, Starost MF, Flores M, Gimenez-Conti IB, Guénet J-L, Conti CJ. Impaired Hair Follicle Morphogenesis and Cycling with Abnormal Epidermal Differentiation in nackt Mice, a Cathepsin L-Deficient Mutation. The American Journal of Pathology. 2002 Aug 1;161(2):693–703.

67.       Lombardi G, Burzyn D, Mundiñano J, Berguer P, Bekinschtein P, Costa H, et al. Cathepsin-L Influences the Expression of Extracellular Matrix in Lymphoid Organs and Plays a Role in the Regulation of Thymic Output and of Peripheral T Cell Number. J Immunol. 2005 Jun 1;174(11):7022.

68.       Reinheckel T., Deussing J., Roth W., Peters C. Towards Specific Functions of Lysosomal Cysteine Peptidases: Phenotypes of Mice Deficient for Cathepsin B or Cathepsin L. bchm. 2005;382(5):735.

69.       Klein L, Kyewski B, Allen PM, Hogquist KA. Positive and negative selection of the T cell repertoire: what thymocytes see (and don’t see). Nature Reviews Immunology. 2014 May 16;14:377.

70.       Palmer E. Negative selection — clearing out the bad apples from the T-cell repertoire. Nature Reviews Immunology. 2003 May 1;3(5):383–91.

71.       Szondy Z, Garabuczi É, Tóth K, Kiss B, Köröskényi K. Thymocyte death by neglect: Contribution of engulfing macrophages. European Journal of Immunology. 2012 Jul 1;42(7):1662–7.

Science Writers Anne Murray
AuthorsJamie Russell, Jin Huk Choi, Xue Zhong, Andon Arnold, Carlos Reyna, Dana Smith, Lauren Prince, and Bruce Beutler