Phenotypic Mutation 'grim'

• Allele: grim
• Mutation Type: missense
• Chromosome: 3
• Coordinate: 107,012,343 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Kcna2
• Gene Name: potassium voltage-gated channel, shaker-related subfamily, member 2
• Synonym(s): Akr6a4, Kca1-2, Kv1.2, Mk-2
• Chromosomal Location: 107,008,462-107,022,321 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Tyrosine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000041702] [ENSMUSP00000142873] [ENSMUSP00000143798]
• AlphaFold: P63141
• SMART Domains: Protein: ENSMUSP00000041702; Gene: ENSMUSG00000040724; AA Change: S308Y

Domain	Start	End	E-Value	Type
BTB	33	133	1.2e-9	SMART
Pfam:Ion_trans	162	421	6.2e-53	PFAM
Pfam:Ion_trans_2	329	414	4.9e-16	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000038695)
• SMART Domains: Protein: ENSMUSP00000142873; Gene: ENSMUSG00000040724; AA Change: S308Y

Domain	Start	End	E-Value	Type
BTB	33	133	1.2e-9	SMART
low complexity region	164	179	N/A	INTRINSIC
Pfam:Ion_trans	224	409	1.3e-36	PFAM
Pfam:Ion_trans_2	329	414	7.9e-16	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000196403)
• SMART Domains: Protein: ENSMUSP00000143798; Gene: ENSMUSG00000040724; AA Change: S308Y

Domain	Start	End	E-Value	Type
BTB	33	133	1.2e-9	SMART
Pfam:Ion_trans	162	421	6.2e-53	PFAM
Pfam:Ion_trans_2	329	414	4.9e-16	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000197470)
• Meta Mutation Damage Score: 0.9139
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:28 PM by Anne Murray
• Record Created: 2019-02-08 12:30 PM by Jamie Russell
• Record Posted: 2019-04-02
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Carlos Reyna, Lauren Prince, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008417; MGI:96659

Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(1) Targeted(4)

Phenotypic Description

Figure 1. Grim mice showed lethality after weaning. Binary data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The grim phenotype was identified among G3 mice of the pedigree R6687, some of which died after weaning (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the postnatal lethality phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R5911. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 33 mutations. The lethality phenotype was linked to a mutation in Kcna2:  a C to A transversion at base pair 107,105,027 (v38) on chromosome 3, or base pair 14,176 in the GenBank genomic region NC_000069. Linkage was found with a recessive model of inheritance (P = 0.000102), wherein three affected mice were homozygous for the variant allele,  and 37 unaffected mice were either heterozygous (N = 21) or homozygous (N = 16) for the reference allele (Figure 2).  A substantial semidominant effect was also observed (P = 0.000237). 

The mutation corresponds to residue 1,604 in the mRNA sequence NM_008417 within exon 3 of 3 total exons.

1588 AGGATTTTCAAGTTGTCCAGACACTCCAAAGGT 303  -R--I--F--K--L--S--R--H--S--K--G-

The mutated nucleotide is indicated in red. The mutation results in a serine to tyrosine substitution at position 308 (S308Y) in the KCNA2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 3. Domain organization and topography of the Kv1.2 potassium channel α subunit. The grim mutation results in a serine to tyrosine substitution at position 308. The locations of the transmembrane domains are shown (S1 through S6). The pore-forming loop (PL) is also indicated.

Figure 4. Structure of a voltage-dependent K⁺ channel (Kv1.2-Kv2.1 paddle chimera channel). A. Two of the four subunits of the tetramer are shown for clarity. B. Single subunit. Transmembrane domains, p-loop, and K⁺ ions are noted.  Click on the structure to view it rotate. UCSF Chimera model is based on PDB 2R9R. Long et al., Nature. Nov 15;450(7168):376-82 (2007). 

KCNA2 encodes the Kv1.2 potassium channel α subunit, a member of the Kv1 (alternatively, Shaker) family of voltage-gated potassium channels. Voltage-gated potassium channels are part of the ion channel superfamily, which also includes voltage-gated sodium (see the record Tremord for information about Scn8a) and calcium channels.

The voltage-gated channels are formed by four α‐subunits, with each subunit having six transmembrane segments (S1 through S6), a membrane reentering P‐loop between the S5 and S6 loop, and cytoplasmic N- and C-termini [Figures 3 and 4; PDB:2R9R; (1;2)]. The first four transmembrane domains (S1 through S4) are the voltage sensor domain (3). The four transmembrane domains are anti-parallel transmembrane helices packed counterclockwise. The last two transmembrane domains from each subunit form the pore domain.

The four α‐subunits form hetero- or homotetramers around the central conducting pore; Kv1.2 can heterodimerize with Kv1.1 and Kv1.4. The tetramer complexes also include four cytoplasmic auxiliary Kv β‐subunits. When the membrane depolarizes, the voltage sensor domains undergo a conformational change, resulting in the opening or closing of the ion permeation pathway (i.e., voltage gating) (4). Four arginines within the S4 domain are responsible for the gating charge controlling the voltage activation of the channel (5). Membrane depolarization causes S4 to move toward the extracellular side of the membrane (6). Within the S6 inner helix (on the intracellular side of the selectivity filter) is a highly conserved triplet sequence (Pro-X-Pro; X is any amino acid) that is important for gating; the gating mechanism is unknown (7;8).

Voltage-gated potassium channels can be inactivated by two mechanisms: N-type and C-type. N-type inactivation occurs when a 30-amino acid globular N-terminal region interacts with the S4-S5 region (9). C-type inactivation involves the S6 region, but the mechanism by which it occurs is unclear (10). The intracellular regions (i.e., the N-terminus, S4-S5 linker, and/or C-terminus) of Kv1.2 interact and confer slowing of voltage-dependent activation (11).

Ser434, Ser440, Ser441, and Ser449 phosphorylation is required for proper Kv1.2 trafficking to the cell surface (12;13). Tyrosine phosphorylation of Kv1.2 within its C-terminal tail regulates its interaction with the actin-binding protein cortactin; cortactin interacts with a C-terminal Kv1.2 tail fragment containing amino acids 446 to 463 (14). Kv1.2-cortactin interaction putatively regulates channel function. Phosphorylation of Tyr132 within the N-terminal tail upon M1 muscarinic acetylcholine receptor activation results in suppression of  Kv1.2-associated ionic currents (15).

Kv1.2 is also N-linked glycosylated at sites in the S1-S2 linker (16). N-linked glycosylation of Kv1.2 promotes surface expression of Kv1.2 as well as its stability at the cell surface (17-19). Ser356, Ser360, Thr383, and Thr384 within the upper portion of the pore region are required for surface expression of Kv1.2 and putatively regulate its N-linked glycosylation (17).

Several individual resides within the length of Kv1.2 have essential functions. Arg354 and Val381 within different regions of the outer pore region are required for proper cell surface expression of Kv1.2 (20). Val370 within the pore helix controls ion selectivity as well as pore stability (21). Thr252 within the S2-S3 linker acts as a switch between slow and fast gating (22).

The grim mutation results in a serine to tyrosine substitution at position 308 (S308Y); Ser308 is within S4.

Expression/Localization

KCNA2 is expressed in the central nervous system. Kv1.2 is predominantly expressed along axons and at axon terminals as well as at presynaptic sites, soma, and proximal dendrites (23-25). Kv1.2 is also found in the juxtaparanodal (JPX) region next to the nodes of Ranvier (NORs), at axonal initial segments (AIS), and in the pinceau region terminals of cerebellar basket cells (26). Kv1.2 localizes to the plasma membrane (25).

Background

Figure 5. Voltage-gated potassium channels in the afferent pain pathway. Nonselective cation channel activation and voltage-gated sodium channels (1) triggers membrane depolarization and action potenital initaition in afferent fibers. The action potentials, produced via the activation of voltage-gated sodium and potassium channels propagate along the axons (2) to synaptic nerve terminals located in the spinal dorsal horn (3). Voltage-gated potassium channels function in action potential initiation and propagation, shaping of action potentials, and regulation of action potential firing patterns. Kv1.2 is a delayed rectifier potassium channel that enables efficient neuronal repolarization after an action potential. Presynaptic Kv1.2 channels suppress synaptic terminal hyperexcitability after an action potential.

Voltage-gated potassium channels allow charged ions to flow rapidly in to or out of the cell in response to membrane potential changes. Voltage-gated potassium channels function in action potential initiation and propagation, shaping of action potentials, and regulation of action potential firing patterns (Figure 5) (26). Kv1.2 is a delayed rectifier potassium channel that enables efficient neuronal repolarization after an action potential. Presynaptic Kv1.2 channels suppress synaptic terminal hyperexcitability after an action potential (27).

Mutations in human KCNA2 are linked to cases of early infantile epileptic encephalopathy 32 (EIEE32; OMIM: #616366) (28-30). Patients with EIEE32 exhibit normal early development, but onset of febrile, hemiclonic, myoclonic, myoclonic-atonic, focal dyscognitive, generalized tonic-clonic, and absence seizures between 5 and 17 months of age (28;30). Some patients show developmental slowing or regression (29). Mutations in KCNA2 have also been linked to cases of hereditary spastic paraplegia (31). Patients with hereditary spastic paraplegia have difficulty walking due to variable muscle weakness and muscle tightness in the legs.

Kcna2-deficient mice showed premature death by approximately postnatal day (P)17 putatively due to apnea during tonic seizures (32;33). Neurons in the mice exhibited less depolarized sustained membrane potentials, reduced mean resting input resistance, and higher amplitude thresholds. The mice showed reduced body weights compared to wild-type littermates (32;33). Mice homozygous for an ENU-induced allele (I402T; Kcna2^Pgu/Pgu) showed postnatal lethality; 50% of mice died between P15 and P35 (34). The mice showed reduced body weights and postnatal growth retardation after P7. The mice also showed severe tremors, impaired coordination, and ataxia on the balance beam as well as reduced grip strength and flattened posture. The mice showed reduced Purkinje cell action potential firing frequency and reduced Purkinje cell spiking frequency compared to wild-type mice. The mice also exhibited increased spontaneous GABAergic inhibitory postsynaptic current frequency and amplitude. Heterozygous mice did not show postnatal lethality, but showed the neurological/behavioral phenotypes observed in the homozygous mice (34).

Putative Mechanism

The lethality observed with the grim mice is similar to that observed in other Kcna2-deficient (and mutant) mouse models, indicating loss of Kv1.2-associated function in the grim mice. Reduced body weights and other neurological phenotypes were not observed/noted.

Primers

PCR Primer
grim_pcr_F: TGGCTTCTTCACCAACATCATG
grim_pcr_R: GGAACCATGTCTCCATAGCC

Sequencing Primer
grim_seq_F: CATGAACATCATTGACATTGTGGC
grim_seq_R: CCATAGCCTACAGTTGTCATGGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 3, + strand):

1   tggcttcttc accaacatca tgaacatcat tgacattgtg gctatcatcc cttactttat
61  caccctgggg acagagttag ctgagaagcc agaggacgcc cagcaaggcc agcaggccat
121 gtcactggcc attctccgtg tcatccggtt ggtaagagtc tttaggattt tcaagttgtc
181 cagacactcc aaaggtctac agattctagg tcagaccctc aaagctagca tgagggaatt
241 gggcctcctg atattcttcc tcttcattgg ggtcatcctc ttctctagtg ctgtctattt
301 tgcagaagct gatgagagag attcccagtt ccccagcatc ccggatgctt tctggtgggc
361 agtcgtctcc atgacaactg taggctatgg agacatggtt cc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Long, S. B., Campbell, E. B., and Mackinnon, R. (2005) Crystal Structure of a Mammalian Voltage-Dependent Shaker Family K+ Channel. Science. 309, 897-903.

  2. Long, S. B., Campbell, E. B., and Mackinnon, R. (2005) Voltage Sensor of Kv1.2: Structural Basis of Electromechanical Coupling. Science. 309, 903-908.

  3. Kubo, Y., Baldwin, T. J., Jan, Y. N., and Jan, L. Y. (1993) Primary Structure and Functional Expression of a Mouse Inward Rectifier Potassium Channel. Nature. 362, 127-133.

  4. Bezanilla, F. (2000) The Voltage Sensor in Voltage-Dependent Ion Channels. Physiol Rev. 80, 555-592.

  5. Seoh, S. A., Sigg, D., Papazian, D. M., and Bezanilla, F. (1996) Voltage-Sensing Residues in the S2 and S4 Segments of the Shaker K+ Channel. Neuron. 16, 1159-1167.

  6. Larsson, H. P., Baker, O. S., Dhillon, D. S., and Isacoff, E. Y. (1996) Transmembrane Movement of the Shaker K+ Channel S4. Neuron. 16, 387-397.

  7. Lu, Z., Klem, A. M., and Ramu, Y. (2002) Coupling between Voltage Sensors and Activation Gate in Voltage-Gated K+ Channels. J Gen Physiol. 120, 663-676.

  8. Hackos, D. H., Chang, T. H., and Swartz, K. J. (2002) Scanning the Intracellular S6 Activation Gate in the Shaker K+ Channel. J Gen Physiol. 119, 521-532.

  9. Hoshi, T., Zagotta, W. N., and Aldrich, R. W. (1990) Biophysical and Molecular Mechanisms of Shaker Potassium Channel Inactivation. Science. 250, 533-538.

  10. Lopez-Barneo, J., Hoshi, T., Heinemann, S. H., and Aldrich, R. W. (1993) Effects of External Cations and Mutations in the Pore Region on C-Type Inactivation of Shaker Potassium Channels. Receptors Channels. 1, 61-71.

  11. Scholle, A., Zimmer, T., Koopmann, R., Engeland, B., Pongs, O., and Benndorf, K. (2004) Effects of Kv1.2 Intracellular Regions on Activation of Kv2.1 Channels. Biophys J. 87, 873-882.

  12. Yang, J. W., Vacher, H., Park, K. S., Clark, E., and Trimmer, J. S. (2007) Trafficking-Dependent Phosphorylation of Kv1.2 Regulates Voltage-Gated Potassium Channel Cell Surface Expression. Proc Natl Acad Sci U S A. 104, 20055-20060.

  13. Johnson, R. P., El-Yazbi, A. F., Hughes, M. F., Schriemer, D. C., Walsh, E. J., Walsh, M. P., and Cole, W. C. (2009) Identification and Functional Characterization of Protein Kinase A-Catalyzed Phosphorylation of Potassium Channel Kv1.2 at Serine 449. J Biol Chem. 284, 16562-16574.

  14. Hattan, D., Nesti, E., Cachero, T. G., and Morielli, A. D. (2002) Tyrosine Phosphorylation of Kv1.2 Modulates its Interaction with the Actin-Binding Protein Cortactin. J Biol Chem. 277, 38596-38606.

  15. Huang, X. Y., Morielli, A. D., and Peralta, E. G. (1993) Tyrosine Kinase-Dependent Suppression of a Potassium Channel by the G Protein-Coupled m1 Muscarinic Acetylcholine Receptor. Cell. 75, 1145-1156.

  16. Zhu, J., Watanabe, I., Poholek, A., Koss, M., Gomez, B., Yan, C., Recio-Pinto, E., and Thornhill, W. B. (2003) Allowed N-Glycosylation Sites on the Kv1.2 Potassium Channel S1-S2 Linker: Implications for Linker Secondary Structure and the Glycosylation Effect on Channel Function. Biochem J. 375, 769-775.

  17. Fujita, T., Utsunomiya, I., Ren, J., Matsushita, Y., Kawai, M., Sasaki, S., Hoshi, K., Miyatake, T., and Taguchi, K. (2006) Glycosylation and Cell Surface Expression of Kv1.2 Potassium Channel are Regulated by Determinants in the Pore Region. Neurochem Res. 31, 589-596.

  18. Thayer, D. A., Yang, S. B., Jan, Y. N., and Jan, L. Y. (2016) N-Linked Glycosylation of Kv1.2 Voltage-Gated Potassium Channel Facilitates Cell Surface Expression and Enhances the Stability of Internalized Channels. J Physiol. 594, 6701-6713.

  19. Watanabe, I., Zhu, J., Sutachan, J. J., Gottschalk, A., Recio-Pinto, E., and Thornhill, W. B. (2007) The Glycosylation State of Kv1.2 Potassium Channels Affects Trafficking, Gating, and Simulated Action Potentials. Brain Res. 1144, 1-18.

  20. Utsunomiya, I., Tanabe, S., Terashi, T., Ikeno, S., Miyatake, T., Hoshi, K., and Taguchi, K. (2010) Identification of Amino Acids in the Pore Region of Kv1.2 Potassium Channel that Regulate its Glycosylation and Cell Surface Expression. J Neurochem. 112, 913-923.

  21. Chao, C. C., Huang, C. C., Kuo, C. S., and Leung, Y. M. (2010) Control of Ionic Selectivity by a Pore Helix Residue in the Kv1.2 Channel. J Physiol Sci. 60, 441-446.

  22. Rezazadeh, S., Kurata, H. T., Claydon, T. W., Kehl, S. J., and Fedida, D. (2007) An Activation Gating Switch in Kv1.2 is Localized to a Threonine Residue in the S2-S3 Linker. Biophys J. 93, 4173-4186.

  23. Wang, H., Kunkel, D. D., Martin, T. M., Schwartzkroin, P. A., and Tempel, B. L. (1993) Heteromultimeric K+ Channels in Terminal and Juxtaparanodal Regions of Neurons. Nature. 365, 75-79.

  24. Wang, H., Kunkel, D. D., Schwartzkroin, P. A., and Tempel, B. L. (1994) Localization of Kv1.1 and Kv1.2, Two K Channel Proteins, to Synaptic Terminals, Somata, and Dendrites in the Mouse Brain. J Neurosci. 14, 4588-4599.

  25. Trimmer, J. S., and Rhodes, K. J. (2004) Localization of Voltage-Gated Ion Channels in Mammalian Brain. Annu Rev Physiol. 66, 477-519.

  26. Robbins, C. A., and Tempel, B. L. (2012) Kv1.1 and Kv1.2: Similar Channels, Different Seizure Models. Epilepsia. 53 Suppl 1, 134-141.

  27. Dodson, P. D., Billups, B., Rusznak, Z., Szucs, G., Barker, M. C., and Forsythe, I. D. (2003) Presynaptic Rat Kv1.2 Channels Suppress Synaptic Terminal Hyperexcitability Following Action Potential Invasion. J Physiol. 550, 27-33.

  28. Syrbe, S., Hedrich, U. B. S., Riesch, E., Djemie, T., Muller, S., Moller, R. S., Maher, B., Hernandez-Hernandez, L., Synofzik, M., Caglayan, H. S., Arslan, M., Serratosa, J. M., Nothnagel, M., May, P., Krause, R., Loffler, H., Detert, K., Dorn, T., Vogt, H., Kramer, G., Schols, L., Mullis, P. E., Linnankivi, T., Lehesjoki, A. E., Sterbova, K., Craiu, D. C., Hoffman-Zacharska, D., Korff, C. M., Weber, Y. G., Steinlin, M., Gallati, S., Bertsche, A., Bernhard, M. K., Merkenschlager, A., Kiess, W., EuroEPINOMICS RES consortium, Gonzalez, M., Zuchner, S., Palotie, A., Suls, A., De Jonghe, P., Helbig, I., Biskup, S., Wolff, M., Maljevic, S., Schule, R., Sisodiya, S. M., Weckhuysen, S., Lerche, H., and Lemke, J. R. (2015) De Novo Loss- Or Gain-of-Function Mutations in KCNA2 Cause Epileptic Encephalopathy. Nat Genet. 47, 393-399.

  29. Pena, S. D., and Coimbra, R. L. (2015) Ataxia and Myoclonic Epilepsy due to a Heterozygous New Mutation in KCNA2: Proposal for a New Channelopathy. Clin Genet. 87, e1-3.

  30. Corbett, M. A., Bellows, S. T., Li, M., Carroll, R., Micallef, S., Carvill, G. L., Myers, C. T., Howell, K. B., Maljevic, S., Lerche, H., Gazina, E. V., Mefford, H. C., Bahlo, M., Berkovic, S. F., Petrou, S., Scheffer, I. E., and Gecz, J. (2016) Dominant KCNA2 Mutation Causes Episodic Ataxia and Pharmacoresponsive Epilepsy. Neurology. 87, 1975-1984.

  31. Helbig, K. L., Hedrich, U. B., Shinde, D. N., Krey, I., Teichmann, A. C., Hentschel, J., Schubert, J., Chamberlin, A. C., Huether, R., Lu, H. M., Alcaraz, W. A., Tang, S., Jungbluth, C., Dugan, S. L., Vainionpaa, L., Karle, K. N., Synofzik, M., Schols, L., Schule, R., Lehesjoki, A. E., Helbig, I., Lerche, H., and Lemke, J. R. (2016) A Recurrent Mutation in KCNA2 as a Novel Cause of Hereditary Spastic Paraplegia and Ataxia. Ann Neurol. 80, 10.1002/ana.24762. Epub 2016 Sep 9.

  32. Brew, H. M., Gittelman, J. X., Silverstein, R. S., Hanks, T. D., Demas, V. P., Robinson, L. C., Robbins, C. A., McKee-Johnson, J., Chiu, S. Y., Messing, A., and Tempel, B. L. (2007) Seizures and Reduced Life Span in Mice Lacking the Potassium Channel Subunit Kv1.2, but Hypoexcitability and Enlarged Kv1 Currents in Auditory Neurons. J Neurophysiol. 98, 1501-1525.

  33. Douglas, C. L., Vyazovskiy, V., Southard, T., Chiu, S. Y., Messing, A., Tononi, G., and Cirelli, C. (2007) Sleep in Kcna2 Knockout Mice. BMC Biol. 5, 42-7007-5-42.

  34. Xie, G., Harrison, J., Clapcote, S. J., Huang, Y., Zhang, J. Y., Wang, L. Y., and Roder, J. C. (2010) A New Kv1.2 Channelopathy Underlying Cerebellar Ataxia. J Biol Chem. 285, 32160-32173.