Phenotypic Mutation 'Muskrat'

• Allele: Muskrat
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 119,538,137 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Mbtps1
• Gene Name: membrane-bound transcription factor peptidase, site 1
• Synonym(s): subtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik
• Chromosomal Location: 119,508,156-119,558,735 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014] ; PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Proline changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000080117] [ENSMUSP00000095965]
• AlphaFold: Q9WTZ2
• SMART Domains: Protein: ENSMUSP00000080117; Gene: ENSMUSG00000031835; AA Change: P341S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	209	464	1.5e-43	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000081381)
• SMART Domains: Protein: ENSMUSP00000095965; Gene: ENSMUSG00000031835; AA Change: P341S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	213	473	3.7e-45	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000098362)
• Meta Mutation Damage Score: 0.3746
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Unknown
• Candidate Explorer Status: CE: failed initial filter
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2020-07-29 6:45 PM by External Program
• Record Created: 2019-02-11 2:33 PM by Jamie Russell
• Record Posted: 2019-03-21
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Andon Arnold, Lauren Prince, Dana Smith, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_019709, NM_001167910; MGI:1927235

Alleles Listed at MGI

All Mutations and Alleles(40) : Chemically induced (ENU)(1) Gene trapped(34) Targeted(5)

Phenotypic Description

Figure 1. Muskrat mice (left) have gray and black coat colors . A wild-type littermate (right) is shown for reference.

The muskrat phenotype was identified among G3 mice of the pedigree R6617, some of which showed black and gray coat colors (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hypopigmentation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R6617. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. The coat color phenotype was linked to a mutation in Mbtps1:  a C to T transition at base pair 119,538,137 (v38) on chromosome 8, or base pair 20,689 in the GenBank genomic region NC_000074. Linkage was found with a recessive model of inheritance (P = 5.716 x 10^-8), wherein six affected mice were homozygous for the variant allele, and 41 unaffected mice were either heterozygous (N = 19) or homozygous for the reference allele (N = 22) (Figure 2). A substantial semidominant effect was also observed (P = 1.231 x 10^-7). 

 

The mutation corresponds to residue 1,609 in the mRNA sequence NM_019709 within exon 9 of 24 total exons.

 

1594 ATTGGCAATGATGGACCTCTCTATGGCACTCTG 336  -I--G--N--D--G--P--L--Y--G--T--L-

 

The mutated nucleotide is indicated in red. The mutation results in a proline to serine substitution at position 341 (P341S) in the  Site 1 protease (S1P) protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 3.  Domain structure of S1P. (A) The signal peptide, prosegment, catalytic domain, growth factor/cytokine receptor family motif (GFCR), region encoded by exon 21, and transmembrane domain (TM) are indicated.  The positions of the catalytic triad residues (D218, H249, S414), and N338 of the oxyanion hole are shown above the diagram.  Amino acid sequences surrounding cleavage sites (downward arrows) for generation of S1P-B, S1P-C, and the shed form of S1P are shown.  Note that in addition to the major cleavage site after K137, cleavage after F133 has also been shown to occur, although to a lesser extent. The muskrat mutation results in a proline to serine substitution at position 341 of the Site 1 protease. This image is interactive. Other mutations found in S1P are noted in red. Click on each mutation for more information. (B) Amino acid numbers and molecular masses are shown for each processed form of S1P.

Mbtps1 encodes Site 1 protease (S1P; alternatively, subtilisin-kexin-isoenzyme 1 [SKI-1]). S1P is a type I transmembrane protein with its N-terminal proteolytic domain projecting into the ER lumen. It contains 1,052 amino acids, comprising a signal peptide (amino acids 1-17), a prosegment (amino acids 18-186), and a catalytic protease domain (amino acids 218-414) (Figure 3) (1). Asp218, His249 and Ser414 comprise the active site catalytic triad (1). Asn338 of S1P forms part of an oxyanion hole, which serves to stabilize the transition state and thereby lower the activation energy of the peptide cleavage reaction. S1P has an extended C-terminal region after the catalytic domain with unknown function (amino acids 415-1052). This region contains a conserved growth factor/cytokine receptor family motif (amino acids 849-861), followed by a putative 24-amino acid hydrophobic transmembrane segment, and a highly basic C-terminal tail that may regulate cellular localization (1;2).

 

S1P is a zymogen activated by autocatalytic cleavage of its prosegment in the ER. First, a signal peptidase removes the signal peptide by cleavage at the sequence LVVLLC₁₇↓GKKHLG resulting in S1P-A (amino acids 18-1052), which is inactive (3;4). Then, sequential autocatalytic cleavages at R₁₃₄SLK₁₃₇↓YA and R₁₈₃RLL₁₈₆↓RA occur to generate the active S1P-B (amino acids 138-1052) and S1P-C (amino acids 187-1052), respectively, plus the major ~24 kDa and 14 kDa prosegment cleavage fragments (3;4). These fragments are further processed into 10- and 8-kDa products. Mutational analysis demonstrates that Arg130 and Arg134 are critical for autocatalytic processing of the prosegment, as well as for the subsequent efficient exit of S1P from the ER (5). Once cleaved, the 14 kDa prosegment fragment reportedly remains tightly bound to S1P, unlike the prosegments of other PCs, which are released by acidic pH and high Ca²⁺ concentrations found in the trans-Golgi network (6). In addition, only the full length 24-kDa prosegment, but none of the smaller fragments, is inhibitory for S1P protease activity towards a synthetic peptide substrate (3). S1P exists as both cell surface transmembrane and extracellularly shed protein forms (1;7). Shedding occurs through cleavage at the sequence KHQKLL₉₅₃↓SIDL (5). 

 

The muskrat mutation results in a proline to serine substitution at position 341 (P341S); Pro341 is within the catalytic domain.

 

Please see the record woodrat for more information about Mbtps1.

Putative Mechanism

S1P cleaves diverse substrates. A group of these substrate proteins are activated from a latent state through regulated intramembrane proteolysis (RIP), a process by which transmembrane proteins are cleaved within a membrane-spanning helix to release cytosolic domains that enter the nucleus (or other cellular compartments) to regulate transcription (or other functions) (8). RIP typically requires an initial cleavage in the extracytoplasmic domain of the substrate before the intramembrane proteolytic event. S1P and the Site 2 protease (S2P) function sequentially to carry out RIP for an expanding list of proteins, with S1P performing the initial extracytoplasmic cleavage (typically in the Golgi), and S2P mediating intramembrane cleavage. RIP substrates for S1P and S2P include the SREBPs (7), and CREB/ATF (cAMP response element binding/activating transcription factor) family proteins including ATF6, CREBH, CREB4, OASIS, and Luman, all of which are transcription factors of the basic leucine zipper family (9-13). Another major group of S1P substrates consists of the surface glycoproteins of viruses, which includes those of the Arenaviruses lymphocytic choriomeningitis virus (LCMV) and Lassa fever virus, and the Bunyavirus Crimean-Congo hemorrhagic fever virus (14-16). S1P has been shown to cleave pro-brain derived neurotrophic factor (BDNF) in vitro (1).

 

Homozygous null mutations of S1P result in embryonic lethality before day 4 due to abnormal epiblast formation and subsequent embryo implantation (17;18). However, an inducible liver-specific knockout of S1P is viable (17). Intraperitoneal injection of poly I:C was used to induce IFN, activating Cre recombination and inactivation of S1P in livers. These animals exhibited reduced levels of nuclear SREBPs, and 74% and 64% reductions of cholesterol and fatty acid biosynthesis, respectively, in hepatocytes. Low density lipoprotein (LDL) receptor mRNA and LDL receptor-mediated clearance of plasma LDL declined by 50%. However, plasma cholesterol levels fell, suggesting that LDL production was reduced. The merely partial effects of conditional deletion of S1P on SREBP activation and lipoprotein biosynthesis were unexpected, as S1P function was presumed to be nonredundant. The data suggest that another protease may substitute for S1P in the liver. Alternatively, the 77-90% efficiency of Cre-mediated recombination may not be sufficient to abolish S1P function.

 

The pigmentation phenotype observed in the muskrat mice mimics that of the woodrat mice (19). The woodrat mice showed normal Mitf expression as well as normal melanocytes in the hair follicle; the functional status of the melanocytes was not tested. The woodrat mice showed aberrant systemic and paracrine processes that promote normal pigmentation; however, a more defined function of S1P in pigmentation has not been determined.

Primers

PCR Primer
Muskrat_pcr_F: TCAGGCCTCTAAACCACAGCTAA
Muskrat_pcr_R: CTTTCTTGGGCATACTTGCAGAA

Sequencing Primer
Muskrat_seq_F: TTGTTACAGCAAGTGGTGAG
Muskrat_seq_R: AAGGACCATGGTTTGGGGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 416 nucleotides is amplified (chromosome 8, - strand):

1   ctttcttggg catacttgca gaaggaccat ggtttgggga cagtgtcgta ttgctactag
61  cactcaataa ctaaatgctt ggttattttg taggtgtggg aattaacagc taacaatgta
121 attatggttt ctgctattgg caatgatgga cctctctatg ggtaagttac cccagcagga
181 taatgtgagg gggtcttact cccttggaat aactgaattg tgtctttagt ctgtgtttct
241 ctgtaccttt gtttatatct gtcttaaact tgatactggg ttttttattt taaaaaggaa
301 tacataatga tccctcaagt cctcaccact tgctgtaaca attgtaagtg gaaaccagtt
361 ttctttatgt taattataaa aaaaaaatac aacttagctg tggtttagag gcctga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Seidah, N. G., Mowla, S. J., Hamelin, J., Mamarbachi, A. M., Benjannet, S., Toure, B. B., Basak, A., Munzer, J. S., Marcinkiewicz, J., Zhong, M., Barale, J. C., Lazure, C., Murphy, R. A., Chretien, M., and Marcinkiewicz, M. (1999) Mammalian subtilisin/kexin Isozyme SKI-1: A Widely Expressed Proprotein Convertase with a Unique Cleavage Specificity and Cellular Localization. Proc. Natl. Acad. Sci. U. S. A.. 96, 1321-1326.

  2. Seidah, N. G., and Prat, A. (2007) The Proprotein Convertases are Potential Targets in the Treatment of Dyslipidemia. J. Mol. Med. (Berl). 85, 685-696.

  3. Toure, B. B., Munzer, J. S., Basak, A., Benjannet, S., Rochemont, J., Lazure, C., Chretien, M., and Seidah, N. G. (2000) Biosynthesis and Enzymatic Characterization of Human SKI-1/S1P and the Processing of its Inhibitory Prosegment. J. Biol. Chem.. 275, 2349-2358.

  4. Espenshade, P. J., Cheng, D., Goldstein, J. L., and Brown, M. S. (1999) Autocatalytic Processing of Site-1 Protease Removes Propeptide and Permits Cleavage of Sterol Regulatory Element-Binding Proteins. J. Biol. Chem.. 274, 22795-22804.

  5. Elagoz, A., Benjannet, S., Mammarbassi, A., Wickham, L., and Seidah, N. G. (2002) Biosynthesis and Cellular Trafficking of the Convertase SKI-1/S1P: Ectodomain Shedding Requires SKI-1 Activity. J. Biol. Chem.. 277, 11265-11275.

  6. Anderson, E. D., VanSlyke, J. K., Thulin, C. D., Jean, F., and Thomas, G. (1997) Activation of the Furin Endoprotease is a Multiple-Step Process: Requirements for Acidification and Internal Propeptide Cleavage. EMBO J.. 16, 1508-1518.

  7. Sakai, J., Rawson, R. B., Espenshade, P. J., Cheng, D., Seegmiller, A. C., Goldstein, J. L., and Brown, M. S. (1998) Molecular Identification of the Sterol-Regulated Luminal Protease that Cleaves SREBPs and Controls Lipid Composition of Animal Cells. Mol. Cell. 2, 505-514.

  8. Ehrmann, M., and Clausen, T. (2004) Proteolysis as a Regulatory Mechanism. Annu. Rev. Genet.. 38, 709-724.

  9. Stirling, J., and O'hare, P. (2006) CREB4, a Transmembrane bZip Transcription Factor and Potential New Substrate for Regulation and Cleavage by S1P. Mol. Biol. Cell. 17, 413-426.

  10. Raggo, C., Rapin, N., Stirling, J., Gobeil, P., Smith-Windsor, E., O'Hare, P., and Misra, V. (2002) Luman, the Cellular Counterpart of Herpes Simplex Virus VP16, is Processed by Regulated Intramembrane Proteolysis. Mol. Cell. Biol.. 22, 5639-5649.

  11. Zhang, K., Shen, X., Wu, J., Sakaki, K., Saunders, T., Rutkowski, D. T., Back, S. H., and Kaufman, R. J. (2006) Endoplasmic Reticulum Stress Activates Cleavage of CREBH to Induce a Systemic Inflammatory Response. Cell. 124, 587-599.

  12. Ye, J., Rawson, R. B., Komuro, R., Chen, X., Dave, U. P., Prywes, R., Brown, M. S., and Goldstein, J. L. (2000) ER Stress Induces Cleavage of Membrane-Bound ATF6 by the Same Proteases that Process SREBPs. Mol. Cell. 6, 1355-1364.

  13. Murakami, T., Kondo, S., Ogata, M., Kanemoto, S., Saito, A., Wanaka, A., and Imaizumi, K. (2006) Cleavage of the Membrane-Bound Transcription Factor OASIS in Response to Endoplasmic Reticulum Stress. J. Neurochem.. 96, 1090-1100.

  14. Lenz, O., ter Meulen, J., Klenk, H. D., Seidah, N. G., and Garten, W. (2001) The Lassa Virus Glycoprotein Precursor GP-C is Proteolytically Processed by Subtilase SKI-1/S1P. Proc. Natl. Acad. Sci. U. S. A.. 98, 12701-12705.

  15. Vincent, M. J., Sanchez, A. J., Erickson, B. R., Basak, A., Chretien, M., Seidah, N. G., and Nichol, S. T. (2003) Crimean-Congo Hemorrhagic Fever Virus Glycoprotein Proteolytic Processing by Subtilase SKI-1. J. Virol.. 77, 8640-8649.

  16. Beyer, W. R., Popplau, D., Garten, W., von Laer, D., and Lenz, O. (2003) Endoproteolytic Processing of the Lymphocytic Choriomeningitis Virus Glycoprotein by the Subtilase SKI-1/S1P. J. Virol.. 77, 2866-2872.

  17. Yang, J., Goldstein, J. L., Hammer, R. E., Moon, Y. A., Brown, M. S., and Horton, J. D. (2001) Decreased Lipid Synthesis in Livers of Mice with Disrupted Site-1 Protease Gene. Proc. Natl. Acad. Sci. U. S. A.. 98, 13607-13612.

  18. Mitchell, K. J., Pinson, K. I., Kelly, O. G., Brennan, J., Zupicich, J., Scherz, P., Leighton, P. A., Goodrich, L. V., Lu, X., Avery, B. J., Tate, P., Dill, K., Pangilinan, E., Wakenight, P., Tessier-Lavigne, M., and Skarnes, W. C. (2001) Functional Analysis of Secreted and Transmembrane Proteins Critical to Mouse Development. Nat. Genet.. 28, 241-249.

  19. Rutschmann, S., Crozat, K., Li, X., Du, X., Hanselman, J. C., Shigeoka, A. A., Brandl, K., Popkin, D. L., McKay, D. B., Xia, Y., Moresco, E. M., and Beutler, B. (2012) Hypopigmentation and Maternal-Zygotic Embryonic Lethality Caused by a Hypomorphic mbtps1 Mutation in Mice. G3 (Bethesda). 2, 499-504.