Phenotypic Mutation 'scant'

• Allele: scant
• Mutation Type: missense
• Chromosome: 12
• Coordinate: 76,432,235 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Zbtb1
• Gene Name: zinc finger and BTB domain containing 1
• Synonym(s): C430003J21Rik
• Chromosomal Location: 76,417,040-76,443,724 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit abnormal thymus, B cell, and T cell differentiation, and reduced numbers of T, B, and NK cells in the spleen. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 75096672 - 80094577 bp
• Amino Acid Change: Cysteine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q91VL9
• SMART Domains: Protein: ENSMUSP00000041955; Gene: ENSMUSG00000033454; AA Change: C74R

Domain	Start	End	E-Value	Type
BTB	24	121	1.01e-16	SMART
ZnF_C2H2	216	242	2.17e1	SMART
low complexity region	359	368	N/A	INTRINSIC
ZnF_C2H2	421	443	3.38e1	SMART
ZnF_C2H2	534	554	1.4e1	SMART
ZnF_C2H2	578	600	2.02e-1	SMART
ZnF_C2H2	606	628	6.23e-2	SMART
ZnF_C2H2	634	656	1.62e0	SMART
ZnF_C2H2	662	684	1.08e-1	SMART
ZnF_C2H2	686	709	1.36e-2	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000042779)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly essential (E-score: 0.698)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 036487-MU
• Last Updated: 2019-02-11 5:32 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2011-12-28
• Science Writers: Nora G. Smart, Anne Murray
• Illustrators: Nora G. Smart, Diantha La Vine
• Authors: Owen M. Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_178744; MGI: 2442326

Alleles Listed at MGI

All alleles(141) : Targeted(5) Gene trapped(136)

Phenotypic Description

The scanT phenotype was initially identified in a flow cytometry screen looking for aberrant percentages of immune cell types in blood from G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU) (Figure 1A) (1). Homozygous scanT animals displayed a severe reduction in CD4⁺ and CD8⁺ T cells, which express T cell receptor αβ subunits. This observation was later extended to T cells including γδ T and natural killer T (NKT) cells (Figure 1B) (1). The thymi of these animals are greatly reduced, and an examination of early T cell development revealed a lack of early thymic precursors (Figure 2A,B) (1).  In the spleens of the mutant mice, the numbers of all lymphocyte lineages (T, B and NK) were reduced while the number of myeloid cells was not (1).

 

Further examination of B cell development in the scanT bone marrow found that there was an accumulation of B cell progenitors at the Hardy Fraction C stage, with a subsequent reduction of progenitors at the later stages (1).  Furthermore, transitional and follicular B cells were reduced in the mutant spleen.  The mutant B cells were able to respond to a T independent immunization, indicating that the B cell defect was developmental rather than functional (1).

To confirm that the mutation in Zbtb1 caused the scanT phenotype, wild-type Zbtb1 was retrovirally transduced into scanT hematopoietic progenitors.  Following transduction, GFP⁺ T cells were recovered from these progenitors indicating that thymic development was restored (1).

The generation of radiation chimeras was used to determine whether the mutant phenotype was hematopoietic or non-hematopoietic in origin.  All blood lymphocytes (with the exception of CD11b⁺ myeloid cells) were wild-type donor-derived, indicating that the Zbtb1 mutant lymphoid progenitors were unable to compete (1).  The numbers (and percentages) of early hematopoietic progenitors, including common lymphoid progenitors (CLPs), were comparable between heterozygous and homozygous scanT mice (1).  The competitive disadvantage in the B and NK cell lineages as well as the degree of embryonic development observed in the scanT mice indicate that Zbtb1 has a specialized role in determining lymphoid fate.

Nature of Mutation

The scanT phenotype was mapped to Chromosome 12 at D12Mit157 with a peak LOD score of 4.13 by crossing the index mouse to a C3H female and intercrossing the F1 offspring (Figure 3A). Sequencing of the coding regions present in the critical region identified a T to C transition at position 15196 in the Genbank genomic region NC_000078 for the Zbtb1 gene on Chromosome 12 (Figure 3B). The mutation corresponds to nucleotide 701 of the Zbtb1 transcript in exon 2 of 2 total exons.

 

15181 AAGATAAGTGCTGAGTGCTTTGATCTCATTTTG

69    -K--I--S--A--E--C--F--D--L--I--L-

 

The mutated nucleotide is indicated in red lettering, and results in a cysteine to arginine substitution at amino acid 74 of the ZBTB1 protein.

Protein Prediction

Figure 4. Domain structures of selected BTB-ZF proteins displaying N-terminal BTB domains and a variable number of C₂H₂ zinc fingers. The shaded proteins have roles in T cell development and function. The structure of LRF is very similar to that of Th-POK, while the BTB domain of ZBTB1 most closely resembles that of MIZ-1. MAZR also contains two AT hooks (not shown). Sequence numbering is for murine proteins. The amino acid altered by the scanT mutation results in a cysteine to arginine substitution at amino acid 74. This image is interactive; click on an allele to view more information about other Zbtb1 mutations.

 

The ZBTB1 protein contains 713 amino acids and is a member of the POK (POZ and Krüppel) or BTB-ZF family of transcription factors (2). Between 40-60 genes encoding POK proteins exist in mammalian genomes (2-4). BTB-ZF family members contain a combination of two domains: an N-terminal BTB (Broad complex, Tramtrack, and Bric à brac) or POZ (Poxviruses and Zinc-finger) domain, and the C₂H₂ Krüppel -type zinc finger motif named for its resemblance to the Drosophila melanogaster segmentation protein Krüppel (Figure 4). Most of these factors play roles in cell proliferation and development, and many have also been implicated as oncogenes or tumor suppressors in cancer (4). Mouse ZBTB1 is 94% identical to its human homologue.  

 

 

The BTB/POZ domain is a highly conserved domain of approximately 100 amino acids that contains a dimerization interface, a possible oligomerization surface, and surfaces for interactions with other factors, such as nuclear corepressors and histone deacetylases (HDACs) (3;5). Based on its protein-protein interaction abilities, a variety of functional roles have been identified for the domain, including transcriptional repression, cytoskeleton regulation, tetramerization and gating of ion channels, and protein ubiquitination/degradation (3). The most conserved region of the BTB domain consists of a core of 5 α-helices flanked by 3 short β-sheets, but various BTB-containing protein families display N- or C-terminal extensions to this core fold. Most members of the BTB-ZF family, including BCL6 (B-cell lymphoma 6), PZLF (promyelocytic leukemia zinc finger) and LRF (leukemia/lymphoa-related factor), have an N-terminal extension containing an additional β-sheet and α-helix that have been shown to form part of a homodimer interface (β1 and α1) (5-8). However, ZBTB1 is missing the N-terminal β -sheet, and has a BTB domain sequence that is most similar to that of MIZ-1 (Myc-interacting zinc-finger protein) with 43.6% identity (Figure 5). The structure of the MIZ-1 BTB domain has been solved (9), and can be described as an association of two dimers to form a tetramer. The two dimeric interfaces of the four MIZ-1 BTB subunits (A:B and C:D) resemble the structures of BCL6, PZLF and LRF homodimers including a hydrophobic interface of α-helices at the center of the structure formed by close packing of α1, α2 and α3 from each subunit (Figure 6A). For BCL6, PZLF and LRF, two β-sheet interfaces at the bottom of this core are formed by the interaction of β1 of one chain with β5 of its partner (Figure 6B) (5-8). This interaction is absent from the MIZ-1 structure due to the absence of β1, but otherwise the dimeric structure is retained. Tetramerization of the MIZ-1 BTB domain results from the association of the dimers at the solvent-exposed β3-β2-β4 fold located at the top of each subunit (A:D and B:C). Association of the dimers results in the displacement of an outer β4 strand from one of the subunits of each dimer, generating a tetramer with two five-stranded β-sheet interfaces. The two displaced β4 strands adopt an α-helical conformation and are then referred to as αx (Figure 6A). The tetramer is stabilized by a salt bridge between aspartic acids located at the N-termini of β4^B/D and lysines at the N-termini of α2^A/C (9). The BTB domain can also promote heterodimerization, and several BTB-ZF proteins are able to physically interact with each other or with other BTB-containing proteins (3;10). Such interactions include BCL6 with BAZF (BCL6 associated zinc finger) and MIZ-1 (11;12), PZLF with FAZF (Fanconi anemia zinc finger) (13), and MAZR (Myc-associated zinc finger protein-related factor) with the transcription factor, BACH2 (BTB and CNC homolog 2) (14).

 

Surface features of BTB-ZF BTB domains determine interactions with specific non-BTB partners. For instance, BCL6 recruits the SMRT (silencing mediator for retinoid and thyroid hormone receptor) corepressor to lateral grooves that extend from the dimer interface across the bottom of the molecule and involves the β1-sheet (7;15) (Figure 6B). A charged pocket that lies at the top between the BCL6, PZLF and LRF dimer subunits has also been implicated in corepressor recruitment. The depth and charge of this pocket, as well as differences in the lateral grooves, determines the specificity of binding partners for various BTB-ZF transcription factors (5-7). In MIZ-1, tetramerization blocks access to the charged pocket. This, along with the lack of the β1-sheet, suggests that MIZ-1 may not be able to bind to corepressors (9). Many of the amino acids that have been determined to be necessary for dimerization and corepressor binding in BTB-ZF factors are mostly conserved in ZBTB1. These include Leu 11, Arg 18, Asp 25 and Lys 39 (15;16). The latter two residues form the charged pocket in BCL6, PZLF and LRF (5-8). 

BTB-ZF proteins generally interact with DNA via C₂H₂-type zinc finger motifs, the most common DNA-binding motifs found in eukaryotes (17). The number of zinc fingers varies widely protein to protein. ZBTB1 contains 8-9 predicted C₂H₂-type zinc finger motifs according to Uniprot (Q91VL9), and analysis using SMART (Simple Modular Architecture Research Tool). These occur at amino acids 216-242, 421-443, 448-470, 534-556, 578-600, 606-628, 634-656, 662-684, 686-709. The C₂H₂ or classical zinc finger contains the consensus sequence (F/Y)-X-C-X_2-5-C-X₃-(F/Y)-X₅-Ψ-X₂-H-X_3-4-H, where X is any amino acid and Ψ is any hydrophobic residue (18). C₂H₂-type zinc fingers fold into a ββα structure and coordinate a zinc ion using the two conserved cysteine and histidine residues. Natural variants of this motif containing a cysteine as the final zinc-chelating residue (C₂HC) also fold into the same structure. C₂H₂ zinc fingers can be divided into three groups based on the number and pattern of fingers: triple- C₂H₂ (binds a single ligand), multiple-adjacent- C₂H₂ (binds multiple ligands), and separated paired- C₂H₂ (19). C₂H₂ zinc fingers typically recognize DNA sequences by binding to the major groove of DNA via residues -1,2,3, and 6 of the α-helix, spanning 3-4 bases of DNA (18;19). An important determinant of specific DNA binding are the amino acid side chains present at these positions (20;21), but conserved linkers between adjacent fingers also play roles by interacting with the phosphate backbone of the DNA and by contacting the C-terminus of the adjacent α-helix through a hydrogen bond (21;22). These motifs have also been shown to bind to both RNA and protein substrates in many proteins (17;19). 

Several BTB-ZF factors, including PLZF, BCL6, FAZF (Fanconi anemia zinc finger), MAZR and LRF, display the ability to interact with multiple protein partners through their zinc fingers (17). These protein-protein interactions typically involve binding to factors present in large transcriptional complexes such as transcription factors, nuclear receptors and corepressors. BTB-ZF proteins can also bind to each other through their zinc fingers, in addition to BTB-domain heterodimerization. BCL6 is able to bind to both PZLF and LRF through its zinc fingers (23;24). Different combinations of zinc fingers in these proteins have been shown to be involved in binding to different partners (17).         

In most BTB-ZF proteins, the zinc fingers are located near the C-terminus and are connected to the BTB domain by an unstructured, flexible linker domain. Thus, dimerized BTB proteins are likely to bind two promoter sites via their zinc fingers, but the exact spacing and orientation of these sites may not be critical depending on the length of the linker region (3). Despite not being well conserved, these domains may still have important functions by interacting with proteins that are part of a transcriptional repression or activation complex. Such interactions include the binding of BCL6 to the corepressor SIN3A (SIN3 homolog A, transcription regulator-yeast) and PZLF binding to the corepressor ETO (eight twenty-one) (16;25). 

ZBTB1 can be phosphorylated on Ser 355 and Thr 356 (26). A putative phosphorylation site exists at Thr 169.

The scanT mutation results in a cysteine to arginine change in the predicted α3 helix of the BTB domain. It is unknown if the affected protein is expressed and localized normally.

Expression/Localization

Zbtb1 gene expression is upregulated during early mouse embryogenesis at roughly embryonic day (E) 9.5 in the mid-foregut (27). In situ hybridization in adult mouse brain shows low levels of expression with highest levels present in the medulla and pons (Allen Brain Atlas). According to SymAtlas, Zbtb1 mRNA is highly expressed in hematopoietic stem cells (HSCs), T cells and mast cells in the mouse, with moderate expression in myeloid cells, osteoblasts and B cells. In humans, ZBTB1 mRNA is expressed in many tissues especially in the heart, liver, skeletal muscle, adrenal cortex, and ganglions. Expression is seen in some lymphoma cell lines.

Background

The founding invertebrate BTB-ZF members are all transcriptional repressors, each regulating different Drosophila developmental processes. The broad-complex (BR-C) factors are essential for Drosophila metamorphosis (28;29). Tramtrack (Ttk) regulates compound eye development (30), and Bric à brac (Bab) is necessary for ovary morphogenesis and limb formation (31;32). In vertebrates, many of these transcription factors appear to mediate transcriptional repression as well and are linked to developmental and tumorigenic processes (4). The developmental roles of BTB-ZF proteins are supported primarily through knockout approaches in mice and other model systems, while roles in tumorigenesis were identified by specific chromosomal aberrations and/or epigenetic modifications involving human genes encoding these factors. For example, PZLF was initially identified due to a chromosomal translocation event that results in a direct fusion of PZLF to the retinoic acid receptor α (RARα) and causes acute promyelocytic leukemia (APL) (33). BCL6 was also identified by being involved in chromosomal translocations that cause certain types of B cell lymphomas (34). The major functions of many of the well-studied vertebrate BTB-ZF transcription factors are listed in Table 1 [please see (2;4;10;35-38) and references therein]. Most BTB-ZF proteins appear to modulate transcription by recruiting transcriptional corepressors such as SIN3A, SMRT and NCoR1 (nuclear receptor corepressor 1), which in turn recruit HDACs resulting in histone deacetylation and transcriptional repression.

 

Table 1. Vertebrate BTB-ZF transcription factors*

 

Protein	Gene	Repressor/Activator	Functions
MIZ-1	Zbtb17	Both	Gastrulation; cell cycle progression; regulator of Myc-mediated gene regulation; interacts with BCL6 in germinal center B cells
HIC-1	Hic1	Repressor	Tumor suppressor; craniofacial development; DNA damage response; inhibits Wnt signaling
Kaiso	Zbtb33	Both	Gastrulation; Wnt signaling; synapse formation
APM-1	Zbtb7c	Repressor	Tumor suppressor; cell growth inhibition
LRF, Pokemon	Zbtb7a	Repressor	Proto-oncogene; stimulates HIV1 Tat activity; erythroid differentiation; represses T cell fate and promotes B cell development
PLZF	Zbtb16	Repressor	Limb development; gene regulation in APL; germ cell maintenance; appropriate differentiation of NKT and γδ T cell subsets
Th-POK, cKrox, Zfp67	Zbtb7B, hcKrox	Repressor	CD4+ T cell fate
MAZR	Zn278, Patz	Repressor	Represses CD8 expression during T cell development
BCL6	Bcl6, Znf51	Repressor	GC formation; germ cell maintenance; regulation of B cell differentiation and B cell lymphomas; regulation of T cell subsets
BCL6b, BAZF	Znf62, Bcl6b	Repressor	Activation of naïve T cells? Memory T cell responses
FAZF, PLZP, ROG, TZFP	Zbtb32, Fazf	Repressor	T cell proliferation; cytokine production; HSC proliferation

* Shaded cells indicates proteins involved in T cell development

 

The majority of T cell development occurs in the thymus, but as thymic progenitor T cells lack self-renewing capacity, T lymphopoiesis requires periodic import of hemataopoietic progenitors from the blood. All blood cell types originate from multipotent, self-renewing hematopoietic stem cells (HSCs), which first differentiate into non-renewing multipotent progenitors (MPPs) through two intermediate steps known as long-term HSCs (LT-HSCs) and short-term HSCs (ST-HSCs) [reviewed by (39;40)]. Factors implicated in stem cell renewal and differentiation include the receptor tyrosine kinases Flt3 (FMS-like tyrosine kinase 3) and c-Kit (see the records for warmflash and Pretty2). Historically, MPPs have been divided into common myeloid progenitors (CMPs) and common lymphoid progenitors (CLPs) in the bone marrow (BM). CMPs give rise to cells of the myeloid lineage, while CLPs give rise to B, T and NK (natural killer) cell lymphocytes. Interleukin (IL)-7 /IL-7R signaling is critical for both B and T cell development, and CLPs were initially identified based on their expression of IL-7Rα (41-43). The current model of HSC differentiation suggests that erythroid potential is lost from MPPs, but myeloid potential is retained in progenitors of lymphocytes after the CLP stage and is only gradually lost through successive stages of differentiation (Figure 7). The stages of lymphoid development in the BM are identified by the expression of specific cell surface markers and the developmental potential of these cells in vitro and in vivo [reviewed by (39;40)], and include early lymphoid progenitors (ELPs) that express high levels of Flt3 and no VCAM-1 (vascular cell adhesion molecule-1;typically expressed on more primitive cell types), CLPs, CLP-2s and a rare BM population known as CTPs (committed T cell progenitors) that are able to differentiate into T cells outside of the thymus (44). 

Although CLPs retain the potential to differentiate into T cells (39), recent evidence suggests that the hematopoietic cells that settle the thymus come from the earlier ELP stage as the earliest T lineage progenitors (ETPs) in the thymus retain myeloid potential and are phenotypically similar to ELPs in the BM (45-47). A subset of ELPs was shown to express CCR9, the receptor for the thymus-expressed chemokine (TECK) or CCL25, which is specifically expressed in the thymus (48;49). The expression of CCR9 on ELPs in the BM may enable these cells to populate the thymus, and recent studies suggest that both CCR9 and CCR7, which recognizes CCL19 and CCL21, together recruit hematopoietic progenitors to the adult thymus (50). Additionally, recruitment of adult thymic progenitors to the thymus is also regulated by the adhesion molecule P-selectin and its ligand PSGL1 (51). Once relocated to the thymus, T cell development goes through several stages leading to the generation of mature T cells including the double negative (DN) stages DN1-4, which lack expression of the T cell coreceptors CD4 and CD8. The most immature DN1 cells are the ETPs, which expess high levels of Kit, but are heterogeneous for other markers including CCR9 and Flt3. The DN2 stage is defined by the expression of both CD44 and the cell surface marker CD25 (the α-chain of the IL-2 receptor), while the DN3 stage is defined by downregulation of CD44 (39;40). Commitment to the T cell lineage is only complete at the DN3 stage where the cells undergo extensive DNA rearrangements at the β, γ, and δ loci in order to express functional TCR chains (52;53). After progressing through the DN4 stage (CD44^-CD25^-), αβ T cells then express both CD4 and CD8 and are known as double positive (DP) cells. They then go through positive selection to become CD4⁺ or CD8⁺ T cells. By contrast, most γδ T cells remain DN as they mature (54). CD4⁺ T cells or T helper cells go on to become several distinct subsets of T cells including T helper cell subsets Th1, Th2, Th3, Th17 and follicular helper (T_FH) cells (please see the record for sanroque), as well as regulatory T cells (T_regs). Other T cell types include natural killer T (NKT) cells, which express receptors normally associated with NK cells and can rapidly produce large amounts of cytokines upon stimulation (55).

One of the factors essential for T cell specification and throughout T cell development is the Notch signaling pathway [reviewed by (56)]. The Notch system consists of interactions between type I membrane receptors (Notch receptors) and the Delta-like (Dll) and Jagged membrane-bound ligands. Notch proteins are synthesized as single precursor proteins that are cleaved in the Golgi, generating an extracellular subunit (N^EC) that is noncovalently linked to the transmembrane/cytoplasmic subunit (N^TM). Notch signaling is initiated by ligand receptor interaction, which induces a second cleavage of Notch near the TM domain mediated by ADAM-type metalloproteases (see the record for wavedX) followed by a third cleavage within the TM. The last cleavage allows the Notch intracellular domain (NICD) to localize to the nucleus and heterodimerize with the transcription factor RBP-J (recombining binding protein suppressor of hairless). Once bound to RBP-J, NICD recruits coactivators such as Mastermind-like 1 (MAML-1), which in turn recruit MED8-mediator transcription activation complexes (see the record for zeitgeist) to the promoters of Notch target genes. In most cells, these target genes include the transcriptional repressor Hes1 (hairy enhancer of split 1), Nrarp (Notch regulated ankyrin repeat protein), Deltex1, and Notch1 itself (57). T cell lineage genes are also directly activated by Notch including Ptcra (encoding the pre-TCRα chain) and Cd25. During T cell development, the strength of Notch signaling determines whether early progenitor populations in the BM adopt a B versus a T cell fate with high levels of Notch signaling favoring T cell differentiation (58). Inducible inactivation of Notch1 or RBP-J results in a block in T cell development accompanied by the accumulation of ectopic B cells in the thymus (59;60). Interference with Notch signaling by transgenic expression of Notch inhibitors including Fringe, Deltex1, or Nrarp also blocks T cell development in the thymus (56). 

In addition to its role in T cell development, a connection between the activation of Notch and leukemia has been recognized.  It is speculated that Notch signaling in B-cell malignancies could be the result of expression of ligands on neighboring cells, of interactions between tumor cells as well as an interaction of the tumor cell with the microenvironment (61).  Evidence suggests that Notch signaling is essential for cross-talk between multiple myeloma cells and their environment (61).  In patients with T-cell acute lymphoblastic leukemia (T-ALL), a chromosomal translocation of Notch1 has been reported (62;63).  There is also a high rate of Notch1 activating mutations in T-ALL, indicating that Notch1 expression is linked to the development of T-ALL (64).  In addition to the role of Notch signaling in T-ALL, approximate 30% of patients with T-lymphotropic virus type I (HTLF-I)-associated adult T-cell leukemia (ATL) have activating Notch1 mutations (65).  The activating mutations are linked to single-substitution mutations that lead to reduced degradation and stabilization of activated Notch (65).  Furthermore, mutations and insertions in activated Notch lead to increased expression of Notch in cancer cells (66).  Furthermore, cancer-causing mutations in proteins that regulate the expression of Notch1 (e.g. CDC4/Fbw7) have been reported (67;68). 

In addition to Notch, a core group of transcription factors are important for T cell determination [reviewed by (69)]. These include factors that are recurrently used during T cell differentiation like GATA-binding protein 3 (GATA3), MYB, basic helix-loop-helix E proteins such as E2A and HEB (HeLa E-box binding factor), high mobility group factor T cell factor 1 (TCF1), the zinc finger growth factor independent 1 transcription repressor (GFI1), the zinc finger Ikaros proteins, and runt-related transcription factor (RUNX) along with its binding partner core binding factor β (CBFβ). Other transcription factors such as the ETS (E26-transformation specific) family factor PU.1 are stage-specific. PU.1 switches from being essential for pre-thymic precursor development to an antagonist of T cell differentiation during the DN2 stages (70-73).  Along with PU.1, Ikaros, RUNX-CBFβ and E2A (and/or HEB) are needed to initiate early T cell differentiation in progenitor cells and are all necessary for the earliest stages of T cell development (74-76). Following this stage, GATA3 is required for differentiation into ETPs while conditional deletions of Gata3 at later stages during T cell development blocks β-selection and the generation of CD4⁺ T cells (77-79). TCF1 and GFI1 are specifically needed to generate DN2 cells (80;81). The zinc-finger transcription factor BCL-11b, HEBalt (HEB, alternative form) and GLI2 (glioma-associated oncogene 2), a transcription factor involved in the hedgehog (Hh) signaling pathway are all turned on at this stage. HEBalt and Hh signaling appear to be necessary for DN2 cells, but BCL-11b is required specifically for αβ T cells (82-85). MYB has critical functions at multiple stages of T cell development, although loss of MYB has little effect on γδ T cells (86-88). In addition to being necessary for the earliest stages of T cell development, RUNX-CBFβ is required to generate DN3 and CD8⁺ T cells (75;82).

Six different BTB-ZF factors are now known to play essential roles during the development and function of T cells (10;36;38), while a seventh, LRF, promotes B cell differentiation in early lymphoid progenitors of the BM by inhibiting Notch signaling and repressing T cell fate (35) (Table 1). All of these proteins are known transcriptional repressors and have been shown to bind DNA. Despite conservation of key residues in their BTB domains, these factors display diverse DNA target sequences and have divergent roles in T cell development and function (10;35;36;38;89;90). Bcl6^-/- mice have increased Th2-specific cytokine responses and inflammation (91), reduced numbers of certain memory T cell subsets (92), and defective differentiation of T cells into T_FH cells (89;90). BAZF, which is highly homologous to BCL6, may act together with BCL6 to repress certain target genes including some normally activated by signal transducer and activator of transcription 6 (STAT6), which promotes Th2 cell differentiation (91;93). BAZF also appears to control a subset of CD8⁺ memory T cell responses (94), and may be important for the proliferative responses of naïve T cells upon stimulation (95). MAZR regulates early T cell development by directly repressing Cd8 transcription in DN thymocytes (96), while PZLF is necessary for the proper differentiation of innate-like T cells including invariant NKT cells and specific subsets of γδ T cells (36;38). Mice with mutations in Zbtb7b, encoding Th-POK (T-helper-inducing POZ/Krüppel-like factor),display reduced numbers of CD4⁺ cells, while transgenic overexpression of Th-POK in the thymus redirects all positively selected T cells into the CD4⁺ lineage (79;97-100). Th-POK is involved in a negative feed back loop with RUNX transcription factors, which repress CD4 expression and allow CD8⁺ T cell development (82;98;99), and is downstream of GATA3 (79).  Th-POK also plays overlapping roles with PZLF in the differentiation of subsets of CD4-expressing NKT and γδT cells (36-38).  Finally, FAZF interacts with GATA3 and represses GATA3-mediated transactivation in CD4⁺ T cells (101;102). FAZF-deficient mice display increased T cell proliferation, cytokine production, and altered HSC homeostasis (102;103).

Putative Mechanism

As described above, several BTB-ZF transcription factors have been shown to play important roles at different stages of T cell development from very early stages with LRF to late stage specification of different T cell subsets. The phenotype of scanT homozygous animals shows that ZBTB1 is essential during lymphoid development, possibly because the mutation causes ZBTB1 to fail to proliferate, to fail to migrate to the thymus, or both (1).  There are several steps where ZBTB1 function may be critical. ZBTB1 may be necessary to promote Notch signaling at the ELP/CLP stage that is necessary for the commitment of these cells to the T cell lineage, and thus may play an opposing role to the one displayed by LRF. In the BM, LRF is able to repress the activation of Notch target genes in CLPs by the moderate levels of Notch ligands expressed in BM stromal cells, while the high expression of Notch ligands in the thymus overcomes LRF repression and allows the specification of T cell fate (35). Since BTB-ZF proteins are typically involved in transcriptional repression, the mechanism by which ZBTB1 may promote Notch signaling could involve repression of Notch inhibitors such as Fringe, Deltex1 or Nrarp. However, many of these proteins are themselves induced by Notch signaling (56). As Notch receptors are typically rapidly degraded by E3-ubiquitin ligases (including Fbw7 in T cells) (104), it is also possible that ZBTB1 may somehow repress this activity to extend Notch signaling in early T cells.

If ZBTB1 is involved in mediating Notch signals in T cell progenitors, it may also act at subsequent stages of T cell development as Notch signaling continues to be critical for committment to the T cell lineage in the thymus. Notch signaling is less critical for the development of γδ T cells as opposed to αβ T cells (54), making it likely that ZBTB1 functions prior to lineage commitment to this cell fate (during DN2 to DN3). Alternatively, ZBTB1 may be necessary to upregulate the expression of homing signals on T cell progenitor cells such as CCR7, CCR9 or PSGL1, thus allowing their migration to the thymus. In addition, ZBTB1 may be necessary to promote the migration of early T cell progenitors in the thymus as multiple chemokines, including CXCL12 (also known as stromal cell-derived factor 1, SDF-1), CCL19, CCL21, and CCL25, have been shown to be important in the homing of developing thymocytes to their specific microenvironment (105). DN thymocytes deficient for the chemokine receptor CXCR4, which recognizes CXCL12, fail to migrate to the cortex and do not differentiate beyond the DN stages (106). However, animals that lack both CCR7 and CCR9, displayed normal thymic cellularity despite severe reductions in the numbers of early thymic progenitors (50), unlike the phenotype observed in scanT animals. 

It is also possible that ZBTB1 plays a T cell-extrinsic role necessary for T cell development. The thymi of scanT animals are very small and suggests the possibility of aberrant thymus development, which would critically affect the maturation of most T cells [reviewed by (105)]. The thymus is divided into the cortex and the medulla with the majority of early T cell development, including positive selection, occurring in the cortex (and the subcapsular zone), while negative selection and the induction of self-tolerance occur in the medulla. Initial T cell differentiation until the DN3 stage is promoted by Notch-mediated signals delivered by binding of the Notch receptor by Delta ligands and is supported by IL-7, both signals derived from cortical thymic epithelial cells (cTECs) (41;43;59). Conversely, immature DN thymocytes also promote the differentiation of thymic stromal cells and trigger the formation of the cortical-epithelial environment in the thymus. Mice homozygous for the human CD3εtransgene overexpress CD3ε during T cell development (see the record for tumormouse), and display a complete block at the DN1 stage in the thymus with differentiation affected even earlier prior to the development of NK cells (107). The thymi of these animals are characterized by very low cellularity and the presence of cysts (108;109). In addition, animals with blocked T cell development due to defects in Notch signaling display a severe reduction of thymus size (59;60).

Despite the conservation of key residues in the BTB domain of ZBTB1, the amino acid altered by the scanT mutation is not conserved with other BTB-containing proteins (Figure 5). Nevertheless, the severe T cell phenotype observed in scanT animals suggests that this residue is important for protein activity, and it is likely that the substitution of an arginine at this position will affect the structure and folding of the ZBTB1 BTB domain.  Other than the severe T cell phenotype observed in scanT mice these animals do not exhibit any other abnormalities. As no other mutations in Zbtb1 have been found in any vertebrate species, it is not clear if the scanT allele is null, hypomorphic or is even a gain-of-function allele.

Primers

Primers cannot be located by automatic search.

Genotyping

ScanT genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

ScanT(F): 5’- TACAGAGGCTCAGGCATGTGACTG -3’

ScanT (R): 5’- AGGTAAAGCTCCGTCCAAAGCG  -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

ScanT _seq(F): 5'- GCTGTATCGCTATCGACGAC -3'

ScanT _seq(R): 5’- CGAGACACACGTTCTTTTGG -3’

 

The following sequence of 1397 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 12, bases 77,485,484 to 77,486,880) is amplified:

 

                        tacagaggc tcaggcatgt gactgggttg ggtgtgtggt gtgtgtatgc

agtggaggcc ggcggtcagc ttgggtgttg ggttgggtgt gtggtgtgtg tgtgcagtgg

aggccagcgg tcagcctcag gtgttgttct tgggtgctgt ctaccttgtt ttttgagaca

gggtttcttg ttggcttaga actttccacg taggctagcc ggttgcagca ggtctcacgg

gtctgtccca tgcgcagctt tgtaaaatgt gtgtttctgg tggtcctcat gcttcctcat

tcgcttatgt ggatacaggg tctcactgag ttgccttggc tagcctggaa cttactctgt

agaccaggct ggtctggaac tcatagagac ctgcctgcct ctgcctcctg agtgtggcta

taagggacta aagactgtcc cagcacccca gacacgtcag ggcctggccc ttatgcttct

cagataagca ctccaccaac tgagaggtct tgggtttaga tttgttttta attttaaaaa

aaaattacgg attttgcttc tgattccttt tttgttcagt atgagaaaat tgaataaatg

actaggtatt ttcatcttca gacttagtag aaaaccatgc tttgattgtc atagcaaagg

tacacaagtg aaagtcatgc tcaagggtcc cttttgaagt gccttcctgc cgcctgaccg

ttacgttttg ttttgcatag gtcgagtcag cagaagatgg caaagcccag ccacagcagc

tatgtcctgc agcagctcaa caaccaaaga gagtggggct ttctctgtga ctgctgtatc

gctatcgacg acatctactt ccaagcacac aaagccgtcc tggctgcctg tagctcctac

tttaggatgt ttttcatgaa ccatcagcac agtactgcac aactgaacct cagcaacatg

aagataagtg ctgagtgctt tgatctcatt ttgcagttca tgtatttagg aaagatcatg

accgctcctt ccagtttcga gcagttcaaa gtggcaatga actacctcca gctgtacaat

gttcctgact gcttggaaga catacaggac gcagactgtt ctagttcaaa gtgttcgtct

tctgcctcca gcaggcagag cagcaagatg atttttgggg tgagaatgta tgaagacacg

gtggctagaa atggcaatga agccaacagg tggtgtgcgg agcccagttc aacggtgaat

acgccgcatc acagagaacc tgaggaagag tctttgcagt tggccaactt ccccgagccg

ctgtttgatg tgtgtaaaaa aagttctgtg tccaaattat ctactccaaa agaacgtgtg

tctcgacgct ttggacggag ctttacct

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

  1. Siggs, O. M., Li, X., and Beutler, B. (2011) ZBTB1 is a Determinant of Lymphoid Development. JEM. .

  2. Costoya, J. A. (2007) Functional Analysis of the Role of POK Transcriptional Repressors. Brief Funct. Genomic Proteomic. 6, 8-18.

  3. Stogios, P. J., Downs, G. S., Jauhal, J. J., Nandra, S. K., and Prive, G. G. (2005) Sequence and Structural Analysis of BTB Domain Proteins. Genome Biol.. 6, R82.

  4. Kelly, K. F., and Daniel, J. M. (2006) POZ for Effect--POZ-ZF Transcription Factors in Cancer and Development. Trends Cell Biol.. 16, 578-587.

  5. Stogios, P. J., Chen, L., and Prive, G. G. (2007) Crystal Structure of the BTB Domain from the LRF/ZBTB7 Transcriptional Regulator. Protein Sci.. 16, 336-342.

  6. Ahmad, K. F., Engel, C. K., and Prive, G. G. (1998) Crystal Structure of the BTB Domain from PLZF. Proc. Natl. Acad. Sci. U. S. A.. 95, 12123-12128.

  7. Ahmad, K. F., Melnick, A., Lax, S., Bouchard, D., Liu, J., Kiang, C. L., Mayer, S., Takahashi, S., Licht, J. D., and Prive, G. G. (2003) Mechanism of SMRT Corepressor Recruitment by the BCL6 BTB Domain. Mol. Cell. 12, 1551-1564.

  8. Schubot, F. D., Tropea, J. E., and Waugh, D. S. (2006) Structure of the POZ Domain of Human LRF, a Master Regulator of Oncogenesis. Biochem. Biophys. Res. Commun.. 351, 1-6.

  9. Stead, M. A., Trinh, C. H., Garnett, J. A., Carr, S. B., Baron, A. J., Edwards, T. A., and Wright, S. C. (2007) A Beta-Sheet Interaction Interface Directs the Tetramerisation of the Miz-1 POZ Domain. J. Mol. Biol.. 373, 820-826.

  10. Bilic, I., and Ellmeier, W. (2007) The Role of BTB Domain-Containing Zinc Finger Proteins in T Cell Development and Function. Immunol. Lett.. 108, 1-9.

  11. Takenaga, M., Hatano, M., Takamori, M., Yamashita, Y., Okada, S., Kuroda, Y., and Tokuhisa, T. (2003) Bcl6-Dependent Transcriptional Repression by BAZF. Biochem. Biophys. Res. Commun.. 303, 600-608.

  12. Phan, R. T., Saito, M., Basso, K., Niu, H., and Dalla-Favera, R. (2005) BCL6 Interacts with the Transcription Factor Miz-1 to Suppress the Cyclin-Dependent Kinase Inhibitor p21 and Cell Cycle Arrest in Germinal Center B Cells. Nat. Immunol.. 6, 1054-1060.

  13. Hoatlin, M. E., Zhi, Y., Ball, H., Silvey, K., Melnick, A., Stone, S., Arai, S., Hawe, N., Owen, G., Zelent, A., and Licht, J. D. (1999) A Novel BTB/POZ Transcriptional Repressor Protein Interacts with the Fanconi Anemia Group C Protein and PLZF. Blood. 94, 3737-3747.

  14. Kobayashi, A., Yamagiwa, H., Hoshino, H., Muto, A., Sato, K., Morita, M., Hayashi, N., Yamamoto, M., and Igarashi, K. (2000) A Combinatorial Code for Gene Expression Generated by Transcription Factor Bach2 and MAZR (MAZ-Related Factor) through the BTB/POZ Domain. Mol. Cell. Biol.. 20, 1733-1746.

  15. Melnick, A., Carlile, G., Ahmad, K. F., Kiang, C. L., Corcoran, C., Bardwell, V., Prive, G. G., and Licht, J. D. (2002) Critical Residues within the BTB Domain of PLZF and Bcl-6 Modulate Interaction with Corepressors. Mol. Cell. Biol.. 22, 1804-1818.

  16. Melnick, A., Ahmad, K. F., Arai, S., Polinger, A., Ball, H., Borden, K. L., Carlile, G. W., Prive, G. G., and Licht, J. D. (2000) In-Depth Mutational Analysis of the Promyelocytic Leukemia Zinc Finger BTB/POZ Domain Reveals Motifs and Residues Required for Biological and Transcriptional Functions. Mol. Cell. Biol.. 20, 6550-6567.

  17. Brayer, K. J., and Segal, D. J. (2008) Keep Your Fingers Off My DNA: Protein-Protein Interactions Mediated by C2H2 Zinc Finger Domains. Cell Biochem. Biophys.. 50, 111-131.

  18. Wolfe, S. A., Nekludova, L., and Pabo, C. O. (2000) DNA Recognition by Cys2His2 Zinc Finger Proteins. Annu. Rev. Biophys. Biomol. Struct.. 29, 183-212.

  19. Iuchi, S. (2001) Three Classes of C2H2 Zinc Finger Proteins. Cell Mol. Life Sci.. 58, 625-635.

  20. Pavletich, N. P., and Pabo, C. O. (1991) Zinc Finger-DNA Recognition: Crystal Structure of a Zif268-DNA Complex at 2.1 A. Science. 252, 809-817.

  21. Elrod-Erickson, M., Rould, M. A., Nekludova, L., and Pabo, C. O. (1996) Zif268 Protein-DNA Complex Refined at 1.6 A: A Model System for Understanding Zinc Finger-DNA Interactions. Structure. 4, 1171-1180.

  22. Laity, J. H., Dyson, H. J., and Wright, P. E. (2000) DNA-Induced Alpha-Helix Capping in Conserved Linker Sequences is a Determinant of Binding Affinity in Cys(2)-His(2) Zinc Fingers. J. Mol. Biol.. 295, 719-727.

  23. Dhordain, P., Albagli, O., Honore, N., Guidez, F., Lantoine, D., Schmid, M., The, H. D., Zelent, A., and Koken, M. H. (2000) Colocalization and Heteromerization between the Two Human Oncogene POZ/zinc Finger Proteins, LAZ3 (BCL6) and PLZF. Oncogene. 19, 6240-6250.

  24. Davies, J. M., Hawe, N., Kabarowski, J., Huang, Q. H., Zhu, J., Brand, N. J., Leprince, D., Dhordain, P., Cook, M., Morriss-Kay, G., and Zelent, A. (1999) Novel BTB/POZ Domain Zinc-Finger Protein, LRF, is a Potential Target of the LAZ-3/BCL-6 Oncogene. Oncogene. 18, 365-375.

  25. Dhordain, P., Lin, R. J., Quief, S., Lantoine, D., Kerckaert, J. P., Evans, R. M., and Albagli, O. (1998) The LAZ3(BCL-6) Oncoprotein Recruits a SMRT/mSIN3A/histone Deacetylase Containing Complex to Mediate Transcriptional Repression. Nucleic Acids Res.. 26, 4645-4651.

  26. Zanivan, S., Gnad, F., Wickstrom, S. A., Geiger, T., Macek, B., Cox, J., Fassler, R., and Mann, M. (2008) Solid Tumor Proteome and Phosphoproteome Analysis by High Resolution Mass Spectrometry. J. Proteome Res.. 7, 5314-5326.

  27. Millien, G., Beane, J., Lenburg, M., Tsao, P. N., Lu, J., Spira, A., and Ramirez, M. I. (2008) Characterization of the Mid-Foregut Transcriptome Identifies Genes Regulated during Lung Bud Induction. Gene Expr. Patterns. 8, 124-139.

  28. Restifo, L. L., and White, K. (1991) Mutations in a Steroid Hormone-Regulated Gene Disrupt the Metamorphosis of the Central Nervous System in Drosophila. Dev. Biol.. 148, 174-194.

  29. Karim, F. D., Guild, G. M., and Thummel, C. S. (1993) The Drosophila Broad-Complex Plays a Key Role in Controlling Ecdysone-Regulated Gene Expression at the Onset of Metamorphosis. Development. 118, 977-988.

  30. Xiong, W. C., and Montell, C. (1993) Tramtrack is a Transcriptional Repressor Required for Cell Fate Determination in the Drosophila Eye. Genes Dev.. 7, 1085-1096.

  31. Sahut-Barnola, I., Godt, D., Laski, F. A., and Couderc, J. L. (1995) Drosophila Ovary Morphogenesis: Analysis of Terminal Filament Formation and Identification of a Gene Required for this Process. Dev. Biol.. 170, 127-135.

  32. Godt, D., Couderc, J. L., Cramton, S. E., and Laski, F. A. (1993) Pattern Formation in the Limbs of Drosophila: Bric a Brac is Expressed in both a Gradient and a Wave-Like Pattern and is Required for Specification and Proper Segmentation of the Tarsus. Development. 119, 799-812.

  33. Chen, Z., Brand, N. J., Chen, A., Chen, S. J., Tong, J. H., Wang, Z. Y., Waxman, S., and Zelent, A. (1993) Fusion between a Novel Kruppel-Like Zinc Finger Gene and the Retinoic Acid Receptor-Alpha Locus due to a Variant t(11;17) Translocation Associated with Acute Promyelocytic Leukaemia. EMBO J.. 12, 1161-1167.

  34. Ye, B. H., Lista, F., Lo Coco, F., Knowles, D. M., Offit, K., Chaganti, R. S., and Dalla-Favera, R. (1993) Alterations of a Zinc Finger-Encoding Gene, BCL-6, in Diffuse Large-Cell Lymphoma. Science. 262, 747-750.

  35. Maeda, T., Merghoub, T., Hobbs, R. M., Dong, L., Maeda, M., Zakrzewski, J., van den Brink, M. R., Zelent, A., Shigematsu, H., Akashi, K., Teruya-Feldstein, J., Cattoretti, G., and Pandolfi, P. P. (2007) Regulation of B Versus T Lymphoid Lineage Fate Decision by the Proto-Oncogene LRF. Science. 316, 860-866.

  36. Kovalovsky, D., Uche, O. U., Eladad, S., Hobbs, R. M., Yi, W., Alonzo, E., Chua, K., Eidson, M., Kim, H. J., Im, J. S., Pandolfi, P. P., and Sant'Angelo, D. B. (2008) The BTB-Zinc Finger Transcriptional Regulator PLZF Controls the Development of Invariant Natural Killer T Cell Effector Functions. Nat. Immunol.. 9, 1055-1064.

  37. Wang, L., and Bosselut, R. (2009) CD4-CD8 Lineage Differentiation: Thpok-Ing into the Nucleus. J. Immunol.. 183, 2903-2910.

  38. Alonzo, E. S., Gottschalk, R. A., Das, J., Egawa, T., Hobbs, R. M., Pandolfi, P. P., Pereira, P., Nichols, K. E., Koretzky, G. A., Jordan, M. S., and Sant'Angelo, D. B. (2010) Development of Promyelocytic Zinc Finger and ThPOK-Expressing Innate Gammadelta T Cells is Controlled by Strength of TCR Signaling and Id3. J. Immunol.. 184, 1268-1279.

  39. Lai, A. Y., and Kondo, M. (2008) T and B Lymphocyte Differentiation from Hematopoietic Stem Cell. Semin. Immunol.. 20, 207-212.

  40. Chi, A. W., Bell, J. J., Zlotoff, D. A., and Bhandoola, A. (2009) Untangling the T Branch of the Hematopoiesis Tree. Curr. Opin. Immunol.. 21, 121-126.

  41. Peschon, J. J., Morrissey, P. J., Grabstein, K. H., Ramsdell, F. J., Maraskovsky, E., Gliniak, B. C., Park, L. S., Ziegler, S. F., Williams, D. E., Ware, C. B., Meyer, J. D., and Davison, B. L. (1994) Early Lymphocyte Expansion is Severely Impaired in Interleukin 7 Receptor-Deficient Mice. J. Exp. Med.. 180, 1955-1960.

  42. Kondo, M., Weissman, I. L., and Akashi, K. (1997) Identification of Clonogenic Common Lymphoid Progenitors in Mouse Bone Marrow. Cell. 91, 661-672.

  43. von Freeden-Jeffry, U., Vieira, P., Lucian, L. A., McNeil, T., Burdach, S. E., and Murray, R. (1995) Lymphopenia in Interleukin (IL)-7 Gene-Deleted Mice Identifies IL-7 as a Nonredundant Cytokine. J. Exp. Med.. 181, 1519-1526.

  44. Garcia-Ojeda, M. E., Dejbakhsh-Jones, S., Chatterjea-Matthes, D., Mukhopadhyay, A., BitMansour, A., Weissman, I. L., Brown, J. M., and Strober, S. (2005) Stepwise Development of Committed Progenitors in the Bone Marrow that Generate Functional T Cells in the Absence of the Thymus. J. Immunol.. 175, 4363-4373.

  45. Allman, D., Sambandam, A., Kim, S., Miller, J. P., Pagan, A., Well, D., Meraz, A., and Bhandoola, A. (2003) Thymopoiesis Independent of Common Lymphoid Progenitors. Nat. Immunol.. 4, 168-174.

  46. Perry, S. S., Wang, H., Pierce, L. J., Yang, A. M., Tsai, S., and Spangrude, G. J. (2004) L-Selectin Defines a Bone Marrow Analog to the Thymic Early T-Lineage Progenitor. Blood. 103, 2990-2996.

  47. Perry, S. S., Pierce, L. J., Slayton, W. B., and Spangrude, G. J. (2003) Characterization of Thymic Progenitors in Adult Mouse Bone Marrow. J. Immunol.. 170, 1877-1886.

  48. Lai, A. Y., and Kondo, M. (2007) Identification of a Bone Marrow Precursor of the Earliest Thymocytes in Adult Mouse. Proc. Natl. Acad. Sci. U. S. A.. 104, 6311-6316.

  49. Schwarz, B. A., Sambandam, A., Maillard, I., Harman, B. C., Love, P. E., and Bhandoola, A. (2007) Selective Thymus Settling Regulated by Cytokine and Chemokine Receptors. J. Immunol.. 178, 2008-2017.

  50. Zlotoff, D. A., Sambandam, A., Logan, T. D., Bell, J. J., Schwarz, B. A., and Bhandoola, A. (2009) CCR7 and CCR9 Together Recruit Hematopoietic Progenitors to the Adult Thymus. Blood. .

  51. Rossi, F. M., Corbel, S. Y., Merzaban, J. S., Carlow, D. A., Gossens, K., Duenas, J., So, L., Yi, L., and Ziltener, H. J. (2005) Recruitment of Adult Thymic Progenitors is Regulated by P-Selectin and its Ligand PSGL-1. Nat. Immunol.. 6, 626-634.

  52. Wada, H., Masuda, K., Satoh, R., Kakugawa, K., Ikawa, T., Katsura, Y., and Kawamoto, H. (2008) Adult T-Cell Progenitors Retain Myeloid Potential. Nature. 452, 768-772.

  53. Bell, J. J., and Bhandoola, A. (2008) The Earliest Thymic Progenitors for T Cells Possess Myeloid Lineage Potential. Nature. 452, 764-767.

  54. Taghon, T., Yui, M. A., Pant, R., Diamond, R. A., and Rothenberg, E. V. (2006) Developmental and Molecular Characterization of Emerging Beta- and Gammadelta-Selected Pre-T Cells in the Adult Mouse Thymus. Immunity. 24, 53-64.

  55. Bendelac, A., Savage, P. B., and Teyton, L. (2007) The Biology of NKT Cells. Annu. Rev. Immunol.. 25, 297-336.

  56. Radtke, F., Fasnacht, N., and Macdonald, H. R. (2010) Notch Signaling in the Immune System. Immunity. 32, 14-27.

  57. Weerkamp, F., Luis, T. C., Naber, B. A., Koster, E. E., Jeannotte, L., van Dongen, J. J., and Staal, F. J. (2006) Identification of Notch Target Genes in Uncommitted T-Cell Progenitors: No Direct Induction of a T-Cell Specific Gene Program. Leukemia. 20, 1967-1977.

  58. Dallas, M. H., Varnum-Finney, B., Delaney, C., Kato, K., and Bernstein, I. D. (2005) Density of the Notch Ligand Delta1 Determines Generation of B and T Cell Precursors from Hematopoietic Stem Cells. J. Exp. Med.. 201, 1361-1366.

  59. Radtke, F., Wilson, A., Stark, G., Bauer, M., van Meerwijk, J., MacDonald, H. R., and Aguet, M. (1999) Deficient T Cell Fate Specification in Mice with an Induced Inactivation of Notch1. Immunity. 10, 547-558.

  60. Han, H., Tanigaki, K., Yamamoto, N., Kuroda, K., Yoshimoto, M., Nakahata, T., Ikuta, K., and Honjo, T. (2002) Inducible Gene Knockout of Transcription Factor Recombination Signal Binding Protein-J Reveals its Essential Role in T Versus B Lineage Decision. Int. Immunol.. 14, 637-645.

  61. Pancewicz, J., and Nicot, C. (2011) Current Views on the Role of Notch Signaling and the Pathogenesis of Human Leukemia. BMC Cancer. 11, 502.

  62. Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C., Smith, S. D., and Sklar, J. (1991) TAN-1, the Human Homolog of the Drosophila Notch Gene, is Broken by Chromosomal Translocations in T Lymphoblastic Neoplasms. Cell. 66, 649-661.

  63. Reynolds, T. C., Smith, S. D., and Sklar, J. (1987) Analysis of DNA Surrounding the Breakpoints of Chromosomal Translocations Involving the Beta T Cell Receptor Gene in Human Lymphoblastic Neoplasms. Cell. 50, 107-117.

  64. Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P.,4th, Silverman, L. B., Sanchez-Irizarry, C., Blacklow, S. C., Look, A. T., and Aster, J. C. (2004) Activating Mutations of NOTCH1 in Human T Cell Acute Lymphoblastic Leukemia. Science. 306, 269-271.

  65. Pancewicz, J., Taylor, J. M., Datta, A., Baydoun, H. H., Waldmann, T. A., Hermine, O., and Nicot, C. (2010) Notch Signaling Contributes to Proliferation and Tumor Formation of Human T-Cell Leukemia Virus Type 1-Associated Adult T-Cell Leukemia. Proc. Natl. Acad. Sci. U. S. A.. 107, 16619-16624.

  66. Sulis, M. L., Williams, O., Palomero, T., Tosello, V., Pallikuppam, S., Real, P. J., Barnes, K., Zuurbier, L., Meijerink, J. P., and Ferrando, A. A. (2008) NOTCH1 Extracellular Juxtamembrane Expansion Mutations in T-ALL. Blood. 112, 733-740.

  67. O'Neil, J., Grim, J., Strack, P., Rao, S., Tibbitts, D., Winter, C., Hardwick, J., Welcker, M., Meijerink, J. P., Pieters, R., Draetta, G., Sears, R., Clurman, B. E., and Look, A. T. (2007) FBW7 Mutations in Leukemic Cells Mediate NOTCH Pathway Activation and Resistance to Gamma-Secretase Inhibitors. J. Exp. Med.. 204, 1813-1824.

  68. Welcker, M., and Clurman, B. E. (2008) FBW7 Ubiquitin Ligase: A Tumour Suppressor at the Crossroads of Cell Division, Growth and Differentiation. Nat. Rev. Cancer.. 8, 83-93.

  69. Rothenberg, E. V., Moore, J. E., and Yui, M. A. (2008) Launching the T-Cell-Lineage Developmental Programme. Nat. Rev. Immunol.. 8, 9-21.

  70. Dakic, A., Metcalf, D., Di Rago, L., Mifsud, S., Wu, L., and Nutt, S. L. (2005) PU.1 Regulates the Commitment of Adult Hematopoietic Progenitors and Restricts Granulopoiesis. J. Exp. Med.. 201, 1487-1502.

  71. Iwasaki, H., Somoza, C., Shigematsu, H., Duprez, E. A., Iwasaki-Arai, J., Mizuno, S., Arinobu, Y., Geary, K., Zhang, P., Dayaram, T., Fenyus, M. L., Elf, S., Chan, S., Kastner, P., Huettner, C. S., Murray, R., Tenen, D. G., and Akashi, K. (2005) Distinctive and Indispensable Roles of PU.1 in Maintenance of Hematopoietic Stem Cells and their Differentiation. Blood. 106, 1590-1600.

  72. Franco, C. B., Scripture-Adams, D. D., Proekt, I., Taghon, T., Weiss, A. H., Yui, M. A., Adams, S. L., Diamond, R. A., and Rothenberg, E. V. (2006) Notch/Delta Signaling Constrains Reengineering of Pro-T Cells by PU.1. Proc. Natl. Acad. Sci. U. S. A.. 103, 11993-11998.

  73. Laiosa, C. V., Stadtfeld, M., Xie, H., de Andres-Aguayo, L., and Graf, T. (2006) Reprogramming of Committed T Cell Progenitors to Macrophages and Dendritic Cells by C/EBP Alpha and PU.1 Transcription Factors. Immunity. 25, 731-744.

  74. Yoshida, T., Ng, S. Y., Zuniga-Pflucker, J. C., and Georgopoulos, K. (2006) Early Hematopoietic Lineage Restrictions Directed by Ikaros. Nat. Immunol.. 7, 382-391.

  75. Talebian, L., Li, Z., Guo, Y., Gaudet, J., Speck, M. E., Sugiyama, D., Kaur, P., Pear, W. S., Maillard, I., and Speck, N. A. (2007) T-Lymphoid, Megakaryocyte, and Granulocyte Development are Sensitive to Decreases in CBFbeta Dosage. Blood. 109, 11-21.

  76. Wojciechowski, J., Lai, A., Kondo, M., and Zhuang, Y. (2007) E2A and HEB are Required to Block Thymocyte Proliferation Prior to Pre-TCR Expression. J. Immunol.. 178, 5717-5726.

  77. Ting, C. N., Olson, M. C., Barton, K. P., and Leiden, J. M. (1996) Transcription Factor GATA-3 is Required for Development of the T-Cell Lineage. Nature. 384, 474-478.

  78. Hernandez-Hoyos, G., Anderson, M. K., Wang, C., Rothenberg, E. V., and Alberola-Ila, J. (2003) GATA-3 Expression is Controlled by TCR Signals and Regulates CD4/CD8 Differentiation. Immunity. 19, 83-94.

  79. Wang, L., Wildt, K. F., Zhu, J., Zhang, X., Feigenbaum, L., Tessarollo, L., Paul, W. E., Fowlkes, B. J., and Bosselut, R. (2008) Distinct Functions for the Transcription Factors GATA-3 and ThPOK during Intrathymic Differentiation of CD4(+) T Cells. Nat. Immunol.. 9, 1122-1130.

  80. Yucel, R., Karsunky, H., Klein-Hitpass, L., and Moroy, T. (2003) The Transcriptional Repressor Gfi1 Affects Development of Early, Uncommitted c-Kit+ T Cell Progenitors and CD4/CD8 Lineage Decision in the Thymus. J. Exp. Med.. 197, 831-844.

  81. Hock, H., Hamblen, M. J., Rooke, H. M., Traver, D., Bronson, R. T., Cameron, S., and Orkin, S. H. (2003) Intrinsic Requirement for Zinc Finger Transcription Factor Gfi-1 in Neutrophil Differentiation. Immunity. 18, 109-120.

  82. Woolf, E., Xiao, C., Fainaru, O., Lotem, J., Rosen, D., Negreanu, V., Bernstein, Y., Goldenberg, D., Brenner, O., Berke, G., Levanon, D., and Groner, Y. (2003) Runx3 and Runx1 are Required for CD8 T Cell Development during Thymopoiesis. Proc. Natl. Acad. Sci. U. S. A.. 100, 7731-7736.

  83. Wang, D., Claus, C. L., Vaccarelli, G., Braunstein, M., Schmitt, T. M., Zuniga-Pflucker, J. C., Rothenberg, E. V., and Anderson, M. K. (2006) The Basic Helix-Loop-Helix Transcription Factor HEBAlt is Expressed in Pro-T Cells and Enhances the Generation of T Cell Precursors. J. Immunol.. 177, 109-119.

  84. El Andaloussi, A., Graves, S., Meng, F., Mandal, M., Mashayekhi, M., and Aifantis, I. (2006) Hedgehog Signaling Controls Thymocyte Progenitor Homeostasis and Differentiation in the Thymus. Nat. Immunol.. 7, 418-426.

  85. Wakabayashi, Y., Watanabe, H., Inoue, J., Takeda, N., Sakata, J., Mishima, Y., Hitomi, J., Yamamoto, T., Utsuyama, M., Niwa, O., Aizawa, S., and Kominami, R. (2003) Bcl11b is Required for Differentiation and Survival of Alphabeta T Lymphocytes. Nat. Immunol.. 4, 533-539.

  86. Emambokus, N., Vegiopoulos, A., Harman, B., Jenkinson, E., Anderson, G., and Frampton, J. (2003) Progression through Key Stages of Haemopoiesis is Dependent on Distinct Threshold Levels of c-Myb. EMBO J.. 22, 4478-4488.

  87. Lieu, Y. K., Kumar, A., Pajerowski, A. G., Rogers, T. J., and Reddy, E. P. (2004) Requirement of c-Myb in T Cell Development and in Mature T Cell Function. Proc. Natl. Acad. Sci. U. S. A.. 101, 14853-14858.

  88. Bender, T. P., Kremer, C. S., Kraus, M., Buch, T., and Rajewsky, K. (2004) Critical Functions for c-Myb at Three Checkpoints during Thymocyte Development. Nat. Immunol.. 5, 721-729.

  89. Yu, D., Rao, S., Tsai, L. M., Lee, S. K., He, Y., Sutcliffe, E. L., Srivastava, M., Linterman, M., Zheng, L., Simpson, N., Ellyard, J. I., Parish, I. A., Ma, C. S., Li, Q. J., Parish, C. R., Mackay, C. R., and Vinuesa, C. G. (2009) The Transcriptional Repressor Bcl-6 Directs T Follicular Helper Cell Lineage Commitment. Immunity. 31, 457-468.

  90. Nurieva, R. I., Chung, Y., Martinez, G. J., Yang, X. O., Tanaka, S., Matskevitch, T. D., Wang, Y. H., and Dong, C. (2009) Bcl6 Mediates the Development of T Follicular Helper Cells. Science. 325, 1001-1005.

  91. Dent, A. L., Shaffer, A. L., Yu, X., Allman, D., and Staudt, L. M. (1997) Control of Inflammation, Cytokine Expression, and Germinal Center Formation by BCL-6. Science. 276, 589-592.

  92. Ichii, H., Sakamoto, A., Kuroda, Y., and Tokuhisa, T. (2004) Bcl6 Acts as an Amplifier for the Generation and Proliferative Capacity of Central Memory CD8+ T Cells. J. Immunol.. 173, 883-891.

  93. Hartatik, T., Okada, S., Okabe, S., Arima, M., Hatano, M., and Tokuhisa, T. (2001) Binding of BAZF and Bc16 to STAT6-Binding DNA Sequences. Biochem. Biophys. Res. Commun.. 284, 26-32.

  94. Manders, P. M., Hunter, P. J., Telaranta, A. I., Carr, J. M., Marshall, J. L., Carrasco, M., Murakami, Y., Palmowski, M. J., Cerundolo, V., Kaech, S. M., Ahmed, R., and Fearon, D. T. (2005) BCL6b Mediates the Enhanced Magnitude of the Secondary Response of Memory CD8+ T Lymphocytes. Proc. Natl. Acad. Sci. U. S. A.. 102, 7418-7425.

  95. Takamori, M., Hatano, M., Arima, M., Sakamoto, A., Fujimura, L., Hartatik, T., Kuriyama, T., and Tokuhisa, T. (2004) BAZF is Required for Activation of Naive CD4 T Cells by TCR Triggering. Int. Immunol.. 16, 1439-1449.

  96. Bilic, I., Koesters, C., Unger, B., Sekimata, M., Hertweck, A., Maschek, R., Wilson, C. B., and Ellmeier, W. (2006) Negative Regulation of CD8 Expression Via Cd8 Enhancer-Mediated Recruitment of the Zinc Finger Protein MAZR. Nat. Immunol.. 7, 392-400.

  97. He, X., He, X., Dave, V. P., Zhang, Y., Hua, X., Nicolas, E., Xu, W., Roe, B. A., and Kappes, D. J. (2005) The Zinc Finger Transcription Factor Th-POK Regulates CD4 Versus CD8 T-Cell Lineage Commitment. Nature. 433, 826-833.

  98. Egawa, T., and Littman, D. R. (2008) ThPOK Acts Late in Specification of the Helper T Cell Lineage and Suppresses Runx-Mediated Commitment to the Cytotoxic T Cell Lineage. Nat. Immunol.. 9, 1131-1139.

  99. Setoguchi, R., Tachibana, M., Naoe, Y., Muroi, S., Akiyama, K., Tezuka, C., Okuda, T., and Taniuchi, I. (2008) Repression of the Transcription Factor Th-POK by Runx Complexes in Cytotoxic T Cell Development. Science. 319, 822-825.

  100. Sun, G., Liu, X., Mercado, P., Jenkinson, S. R., Kypriotou, M., Feigenbaum, L., Galera, P., and Bosselut, R. (2005) The Zinc Finger Protein cKrox Directs CD4 Lineage Differentiation during Intrathymic T Cell Positive Selection. Nat. Immunol.. 6, 373-381.

  101. Miaw, S. C., Choi, A., Yu, E., Kishikawa, H., and Ho, I. C. (2000) ROG, Repressor of GATA, Regulates the Expression of Cytokine Genes. Immunity. 12, 323-333.

  102. Miaw, S. C., Kang, B. Y., White, I. A., and Ho, I. C. (2004) A Repressor of GATA-Mediated Negative Feedback Mechanism of T Cell Activation. J. Immunol.. 172, 170-177.

  103. Piazza, F., Costoya, J. A., Merghoub, T., Hobbs, R. M., and Pandolfi, P. P. (2004) Disruption of PLZP in Mice Leads to Increased T-Lymphocyte Proliferation, Cytokine Production, and Altered Hematopoietic Stem Cell Homeostasis. Mol. Cell. Biol.. 24, 10456-10469.

  104. Thompson, B. J., Buonamici, S., Sulis, M. L., Palomero, T., Vilimas, T., Basso, G., Ferrando, A., and Aifantis, I. (2007) The SCFFBW7 Ubiquitin Ligase Complex as a Tumor Suppressor in T Cell Leukemia. J. Exp. Med.. 204, 1825-1835.

  105. Takahama, Y. (2006) Journey through the Thymus: Stromal Guides for T-Cell Development and Selection. Nat. Rev. Immunol.. 6, 127-135.

  106. Plotkin, J., Prockop, S. E., Lepique, A., and Petrie, H. T. (2003) Critical Role for CXCR4 Signaling in Progenitor Localization and T Cell Differentiation in the Postnatal Thymus. J. Immunol.. 171, 4521-4527.

  107. Hollander, G. A., Wang, B., Nichogiannopoulou, A., Platenburg, P. P., van Ewijk, W., Burakoff, S. J., Gutierrez-Ramos, J. C., and Terhorst, C. (1995) Developmental Control Point in Induction of Thymic Cortex Regulated by a Subpopulation of Prothymocytes. Nature. 373, 350-353.

  108. Klug, D. B., Carter, C., Crouch, E., Roop, D., Conti, C. J., and Richie, E. R. (1998) Interdependence of Cortical Thymic Epithelial Cell Differentiation and T-Lineage Commitment. Proc. Natl. Acad. Sci. U. S. A.. 95, 11822-11827.

  109. van Ewijk, W., Hollander, G., Terhorst, C., and Wang, B. (2000) Stepwise Development of Thymic Microenvironments in Vivo is Regulated by Thymocyte Subsets. Development. 127, 1583-1591.