Phenotypic Mutation 'Jeju' (pdf version)
AlleleJeju
Mutation Type missense
Chromosome11
Coordinate106,312,713 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Cd79b
Gene Name CD79B antigen
Synonym(s) Igbeta, Ig-beta, Igb, B29
Chromosomal Location 106,311,341-106,314,762 bp (-)
MGI Phenotype FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008339, NM_001313939; MGI:96431

Mapped Yes 
Amino Acid Change Glycine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000048239] [ENSMUSP00000129029]
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592
AA Change: G176D

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000044228)
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592
AA Change: G116D

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000167143)
Meta Mutation Damage Score 0.9440 question?
Is this an essential gene? Probably nonessential (E-score: 0.162) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1 cells - decreased
FACS CD4+ T cells - increased
FACS T cells - increased
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.806
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(17) : Chemically induced (ENU)(1) Gene trapped(2) Spontaneous(1) Targeted(10) Transgenic(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
hallasan UTSW 11 106312441 critical splice acceptor site probably null
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0731:Cd79b UTSW 11 106312433 missense probably damaging 1.00
R4400:Cd79b UTSW 11 106312010 nonsense probably null
R4591:Cd79b UTSW 11 106312046 missense probably damaging 1.00
R4948:Cd79b UTSW 11 106312861 missense probably benign 0.01
R6214:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6215:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6605:Cd79b UTSW 11 106312713 missense probably damaging 1.00
R7111:Cd79b UTSW 11 106314539 missense possibly damaging 0.73
R7114:Cd79b UTSW 11 106311887 missense probably damaging 1.00
R7401:Cd79b UTSW 11 106312852 missense probably benign 0.02
R8052:Cd79b UTSW 11 106313700 missense probably damaging 0.97
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:28 PM by Anne Murray
Record Created 2019-02-22 4:47 PM by Bruce Beutler
Record Posted 2019-02-28
Phenotypic Description

Figure 1. Jeju mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Jeju mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Jeju mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Jeju phenotype was identified among G3 mice of the pedigree R6605, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) and B1 cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the reduced B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R6605. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd79b:  a G to A transition at base pair 106,312,713 (v38) on chromosome 11, or base pair 1,850 in the GenBank genomic region NC_000077. The strongest association was found with an additive model of inheritance to the normalized B1 cell frequency, wherein six variant homozygotes and 21 heterozygous mice departed phenotypically from 19 homozygous reference mice with a P value of 2.064 x 10-17 (Figure 4).  

 

The mutation corresponds to residue 425 in the mRNA sequence NM_008339 within exon 3 of 6 total exons.

 

409 CAGTACGAGGATAATGGTATCTACTTCTGCAAG

111 -Q--Y--E--D--N--G--I--Y--F--C--K-

 

The mutated nucleotide is indicated in red. The mutation results in a glycine to aspartic acid substitution at position 116 (G116D) in the CD79B protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction
Figure 5. Domain structure of Igβ. The Jeju mutation is indicated. Abbreviations: SP, signal peptide; TM, transmembrane domain; ITAM, immunoreceptor tyrosine-based activation motif. See the text for more details. Click the other mutations to view more information.

B cell antigen receptors (BCR) consist of two functional components [reviewed in (1)].  The antigen binding component is a membrane bound form of immunoglobulin (mIg), which consists of two transmembrane spanning heavy (H) chains and two associated light (L) chains.  A heterodimer of Igα (see the record for crab) and Igβ constitutes the signaling component of the BCR (2-4).  The Igα/Igβ heterodimer associates noncovalently with all mIg isotypes (IgM, IgD, IgG, IgA, and IgE) (5), and is found in each BCR complex in a 1:1 stoichiometry with mIg (6).

 

Igβ is a type I transmembrane glycoprotein of approximately 40 kD in mice (Figure 5).  Igβ consists of 228 and 229 amino acids in mice and humans, respectively, and are 68% identical. The cytoplasmic tail of Igβ is 48 amino acids in length and contains a single immunoreceptor tyrosine-based activation motif (ITAM) (7), a conserved domain containing two tyrosines that upon phosphorylation act as a binding site for SH2 domain-containing effectors (D/ExxxxxxxD/ExxYxxL/IxxxxxxxYxxL/I).  BCR activation results in the phosphorylation of ITAM tyrosines in both Igα and Igβ by membrane-localized Src family kinases, which are subsequently recruited to the receptor through binding of the phosphorylated ITAMs to Src SH2 domains, thereby amplifying signaling (8)

 

The extracellular N-terminus of Igβ forms a V-type Ig fold (9). The extracellular domains of Igα and Igβ each contain features that are highly conserved in Ig superfamily proteins, including two cysteine residues that form an intrachain disulfide bond (Cys50 and Cys101 in Igα; Cys65 and Cys120 in Igβ), as well as several other conserved residues (10;11).  The predicted Ig fold of Igβ was confirmed by X-ray crystallographic analysis, which demonstrated an I-type rather than a V-type fold (Figure 3; PDB ID 3KHQ) (12).  Igα and Igβ each contain an additional extracellular cysteine residue (Cys113 and Cys135, respectively); these form an interchain disulfide bond that mediates heterodimerization of the proteins (12;13).  The function of the extracellular domains of Igα/Igβ in BCR signaling is not well understood.  They contribute to interactions with mIg (3;12;14), and may be required for transport of mIgM to the cell surface (15).

 

The Jeju mutation results in a glycine to aspartic acid substitution at position 116 (G116D) in the CD79B protein; Gly116 is within the Ig-like V-type domain.

 

Please see the record hallasan for more information about Cd79b.

Putative Mechanism

Once phosphorylated on both tyrosines, the Igα/Igβ ITAMs serve as docking sites for the adapter protein BLNK (16) and the two SH2 domains of Syk (see the record for poppy), which is then activated by SFK-dependent trans-phosphorylation (17-20).  Syk-deficient B cells are deficient in downstream BCR signaling responses, but display normal SFK activation and Igα/Igβ phosphorylation, indicating that Syk is essential for transmitting signals from the BCR to distal signaling molecules (21).  Syk phosphorylates a number of targets including BLNK (see the record for busy), PLC-γ2 (see the record for queen), and PKCβ (see the record for untied).  BLNK serves as a scaffold to bring together several important signaling molecules (22;23).  In particular, phosphorylated BLNK provides docking sites for the tyrosine kinase Btk as well as PLC-γ2, resulting in phosphorylation and activation of PLC-γ2 by Btk (24;25).

 

Igα and Igβ were proposed to promote V(D)J recombination (see maladaptive).  However, pro-B cells from Igα- and Igβ-deficient mice initiated and completed V(D)J recombination as well wild type cells (26).  Despite normal V(D)J recombination, these cells failed to express the pre-BCR (a complex composed of the recombined mIgM heavy chain, the surrogate light chains λ5 and VpreB, and the Igα/Igβ heterodimer) on the cell surface, and B cell development was blocked at the pro-B cell stage (26;27).  In mature B cells, signaling through Igα/Igβ is required for cell survival. 

 

In mice expressing Igβ truncated after the third amino acid of the cytoplasmic domain, B cell development proceeds up through the immature B stage (28).  In contrast, B cell progression is impaired before the pre-B stage (50% reduction of pre-B cells) and severely impaired beyond it (80% reduction of immature B cells) in mice with a deletion of 40 of the 61 amino acids of the Igα cytoplasmic domain (29).  Furthermore, a negative regulatory role of the Igα cytoplasmic domain was suggested by the observation of increased tyrosine phosphorylation and calcium flux in B cells with cytoplasmically truncated Igα (30;31).  Phosphorylation of serine and threonine residues in the Igα tail has been implicated in such negative signaling (32).

 

The phenotype of the Jeju mice is consistent with a loss of function of Igβ. 

Primers PCR Primer
Jeju_pcr_F: TGGGGACTCTAGAATCATAGCC
Jeju_pcr_R: GAAGCCCTTGTTCCCAGATC

Sequencing Primer
Jeju_seq_F: GGGGACTCTAGAATCATAGCCACTTC
Jeju_seq_R: AGCACCCGAGGTTTGCAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 11, - strand):


1   gaagcccttg ttcccagatc tggcagcacc cgaggtttgc agccaaaaag cggagctcca
61  tggtgaagtt tcactgctac acaaaccact caggtgcact gacctggttc cgaaagcgag
121 ggagccagca gccccaggaa ctggtctcag aagagggacg cattgtgcag acccagaatg
181 gctctgtcta caccctcact atccaaaaca tccagtacga ggataatggt atctacttct
241 gcaagcagaa atgtgacagc gccaaccata atgtcaccga cagctgtggc acggaacttc
301 tagtcttagg tgtgtgcaag gtagattgtg tagccatcca cacccactcc ccagctcagc
361 ctacctacca ggggaagtgg ctatgattct agagtcccca 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler