Phenotypic Mutation 'want_to' (pdf version)
Allelewant_to
Mutation Type missense
Chromosome1
Coordinate36,782,517 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539 (variant 1), NM_001289612 (variant 2), NM_001289765 (variant 3), NM_001289766 (variant 4); MGI: 99613

Mapped Yes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027291]
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: Y597C

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000027291)
Meta Mutation Damage Score 0.2894 question?
Is this an essential gene? Probably nonessential (E-score: 0.233) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD44+ CD8 MFI - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS naive CD8 T cells in CD8 T cells - decreased
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.646
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(32) : Chemically induced (ENU)(11) Chemically induced (other)(1) Gene trapped(1) Spontaneous(2) Targeted (12) Transgenic(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense probably damaging 1.00
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
zapatos UTSW 1 36771181 missense possibly damaging 0.89
zipper UTSW 1 36770902 missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36778751 missense probably benign
R7704:Zap70 UTSW 1 36779314 critical splice donor site probably null
R7769:Zap70 UTSW 1 36770902 missense probably benign 0.09
R8115:Zap70 UTSW 1 36781206 missense probably damaging 1.00
R8140:Zap70 UTSW 1 36771181 missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36781137 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36779176 nonsense probably null
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:28 PM by Anne Murray
Record Created 2019-02-28 10:03 PM by Bruce Beutler
Record Posted 2019-03-07
Phenotypic Description

Figure 1. Want_to mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Want_to mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The want_to phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6694, some of which showed reduced frequencies of naïve CD8 T cells in CD8 T cells (Figure 1) with concomitant increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased central memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 42 mutations (X-axis) identified in the G1 male of pedigree R6694. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 42 mutations. Both of the above anomalies were linked by continuous variable mapping to mutations a mutation in Zap70: an A to G transition at base pair 36,782,517 (v38) on chromosome 1, or base pair 20,720 in the GenBank genomic region NC_000067 encoding Zap70.  The strongest association was found with a recessive model of inheritance to the normalized central memory CD8 T cell frequency, wherein 12 variant homozygotes departed phenotypically from 13 homozygous reference mice and 28 heterozygous mice with a P value of 3.068 x 10-11 (Figure 3).

 

The mutation corresponds to residue 1,952 in the mRNA sequence NM_001289766 within exon 13 of 13 total exons.

 

1936 ATGCGGAACTATTACTACAGCCTGGCCAGCCGG

592  -M--R--N--Y--Y--Y--S--L--A--S--R-

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to cysteine substitution at position 597 (Y597C) in the ZAP70 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 4. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The want_to mutation causes a tyrosine to cysteine substitution at position 597. The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Other mutations found in ZAP-70 are noted in red. Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The ζ-associated protein of 70 kDa (ZAP-70) is a protein tyrosine kinase (PTK) that binds to the doubly phosphorylated immunoreceptor tyrosine-based activation motifs (ITAMS) of ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse). ZAP70 consists of two N-terminal Src-homology 2 (SH2) domains at amino acids and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A, while the region between the second SH2 and catalytic domains is known as interdomain B (2). The two SH2 domains of mouse ZAP-70 occur at amino acids 10-102 and 163-254, and work cooperatively to bind to the phosphorylated tyrosines of an ITAM sequence [(D/E)xxYxxI/Lx(6-8)YxxI/L].

 

The want_to mutation results in a tyrosine to cysteine substitution at position 597 (Y597C); Tyr597 is within the kinase domain.

 

Please see the record for murdock for more information about Zap70.

Putative Mechanism

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (3;4)]. Syk and ZAP-70 function as critical mediators of pre-TCR and TCR signaling, with ZAP-70 having a predominant role in mature T cells (4;5). Once activated, ZAP-70 and Syk interact with and phosphorylate a number of substrates important for TCR signaling including the adaptor proteins the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6;7). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. Zap70 knockout mice display an arrest of T cell development at the DP stage, the second critical checkpoint important during αβ T cell development due to defective TCR-mediated selection and signaling at this stage (5;8). Although ZAP-70 has a critical role in T cell development and function, it also plays a role downstream of the BCR and in NK cells. Zap70 knockout mice display normal B cell development, mount normal antibody responses and also proliferate appropriately to various stimuli (9).  The phenotype of the want_to mice is similar to loss-of-function alleles of Zap70.

Primers PCR Primer
want_to_pcr_F: GCAGCTTTGCTTGTTAAGGC
want_to_pcr_R: AGCCCACTGGTGATGTTTAC

Sequencing Primer
want_to_seq_F: TTCCATCCATCTCATACCAAGGAG
want_to_seq_R: GGTGATGTTTACCAATATCCCATCAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 423 nucleotides is amplified (chromosome 1, + strand):


1   gcagctttgc ttgttaaggc tgggcgcccc agaattccat ccatctcata ccaaggagac
61  ctcatccaac agccctccct cctctgagcc ccaaaagtct gccccaactc cctatccctt
121 ggtacctttc tgccctctgg ctgaggctgg gttctgggtc ttcccaacag gtgggaggat
181 cgccccgact tcctgactgt ggaacaacgt atgcggaact attactacag cctggccagc
241 cgggccgagg gacccccaca gtgtgaacag gtggccgagg ctgcatgtgg ctgagcccca
301 agcctcccta caccctctgt ccaggatgac ctgtgttcag gagccctatc gactgtccca
361 tgtgattcgc cccgccccat gggctggggc tgatgggata ttggtaaaca tcaccagtgg
421 gct


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler