Phenotypic Mutation 'mister_clean' (pdf version)
List |< first << previous [record 37 of 74] next >> last >|
Allelemister_clean
Mutation Type critical splice donor site (1 bp from exon)
Chromosome14
Coordinate70,560,065 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Hr
Gene Name hairless
Synonym(s) ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
Chromosomal Location 70,552,212-70,573,548 bp (+)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Accession Number
NCBI RefSeq: NM­_021877; MGI: 96223
Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000022691 (fasta)
Ensembl: ENSMUSP00000124042 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 305 327 N/A INTRINSIC
low complexity region 345 359 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 701 715 N/A INTRINSIC
low complexity region 746 757 N/A INTRINSIC
JmjC 939 1150 5.23e-38 SMART
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (DSS Male) - decreased
DSS: sensitive day 10
DSS: sensitive day 7
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1a cells in B1 cells - decreased
FACS B1b cells - increased
FACS B1b cells in B1 cells - increased
FACS B2 cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM MFI - increased
FACS IgM+ B cells - decreased
FACS macrophages - increased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS T cells - decreased
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(25) : Targeted, knock-out(1) Targeted, other(2) Transgenic(1) Spontaneous(15) Chemically induced(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
kaburo UTSW 14 unclassified
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 031039-UCD
Last Updated 2018-03-02 4:47 PM by Diantha La Vine
Record Created unknown
Record Posted 2009-03-05
Phenotypic Description

The mister clean mutant phenotype emerged as a visible variant among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU).  The index mouse was completely hairless by weaning age and exhibited wrinkled skin (Figure 1).  They are phenotypically similar to prune mice, which have a mutation in the hr gene.

Nature of Mutation
Due to the similarity in phenotype with prune mice, the hr locus was directly sequenced and a G to A transition was found in the donor splice site of intron 6 one nucleotide after the last exon (GTGAGC -> ATGAGC) in the hr gene on chromosome 14 (position 6009 in Genbank genomic region NC_000080 for linear genomic DNA sequence of hr).  The mutation may result in skipping of the 191-nucleotide exon 6 (out of 20 total exons) in ENSMUST00000022691, destroying the reading frame in the middle of the encoded HR polypeptide chain (33 aberrant amino acids after position 515), and creating a premature stop codon that would truncate the protein after amino acid 548.  The effect of the mutation at the cDNA and protein level has not been tested.
 
       <--exon 5  <--exon 6 intron 6-->  exon 7-->   <--exon 7
5724 AAATCACGTAG……AGCGAGAAG GTGAGCCAA…………GCCAGGGGCC……CCACTGTAG 7859
512  -K--S--R--………Q--R--E--             R--P--G--A-……-P--L--*  548
      correct     deleted                       aberrant
 
The donor splice site of intron 6, which is destroyed by the mister clean mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.
 
In the ENSMUST00000163060 transcript, the mutation corresponds to the donor splice site of intron 4. The mutation may result in skipping of the 191-nucleotide exon 4 (out of 18 total exons), destroying the reading frame in the middle of the encoded HR polypeptide chain (33 aberrant amino acids after position 515), and creating a premature stop codon that would truncate the protein after amino acid 642. 
 
       <--exon 3  <--exon 4 intron 4-->  exon 5-->   <--exon 5
1621 AAATCACGTAG……AGCGAGAAG GTGAGCCAA…………GCCAGGGGCC……CCACTGTAG 1925
541  -K--S--R--………Q--R--E--             R--P--G--A-……-P--L--*  642
      correct     deleted                       aberrant
Protein Prediction

Figure 2. HR functional domains. The N-terminal domain varies between the two isoforms of HR; only the longer isoform is shown. The position of the mister clean mutation is indiated in red and results in a G to A transition in the donor splice site of intron 4 of the isoform encoded by the cDNA transcript ENSMUST00000163060, or at donor splice site of intron 6 of the isoform encoded by the ENSMUST00000022691 cDNA transcript (not shown). NMTS, nuclear matrix targeting signal; RD, repression domain; NLS, nuclear localization signal; ID, interacting domain; ZF, zinc finger domain; ROR, retinoic acid receptor related orphan receptor; TR, thyroid hormone receptor. Click on the image to view other mutations found in HR. Click on each mutation for more specific information.

The mister clean mutation likely results in the loss or weakening of the normal donor splice site of intron 4, which may lead to skipping of exon 4, a frame shift and premature truncation after the addition of 33 aberrant amino acids (Figure 2).  Exon 4 does not encode any defined portion of the HR protein.  Truncation occurs after the localization sequences and the first repressor domain.  If the truncated protein was expressed, it would be missing the zinc finger, the JmjC domain, as well as two defined repression domains and nuclear receptor interacting motifs.

Please see the record for prune for more information about Hairless.

 

Putative Mechanism
The phenotype of hr alleles is correlated with genotype.  Thus, classical hairless mice that exhibit hairlessness, but not thickened and wrinkled skin, typically express some level of functional protein, while animals with severe versions of the rhino phenotype do not.  The mister clean mutation is predicted to result in truncation of the HR protein, similar to some of the rhino alleles (1).  Although mister clean mutants display some thickening and wrinkling of the skin, their phenotypes do not appear as severe as prune or knockout hr animals suggesting that some correct or alternative splicing may occur in these animals along with the retention of some HR function. 
Primers Primers cannot be located by automatic search.
Genotyping
Mister clean genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  
 
Primers for PCR amplification
MrClean(F): 5’- CCATCCGTCCACGTTGGAATCATC -3’
MrClean(R): 5’- TGCACTGGCTGTTTCCTCCATAAG -3’
 
PCR program (use SIGMA JumpStart REDTaq)
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
MrClean_seq(F1): 5’- CTTCCTAGAGACTTGGGCTGAAC -3'
MrClean_seq(F2): 5’- AGACTTGTGGATACATCCTGC -3’
MrClean_seq(R): 5’- GACTGGACCAAGTCTTTAGACTC -3’
 
The following sequence of 1033 nucleotides (from Genbank genomic region NC_000080 for linear DNA sequence of hr) is amplified:
 
5210                                                      c catccgtcca
5221 cgttggaatc atctcacagt gtcacatagc cacttagcct ttagctgacc tacccaaagt
5281 ctatactggc tggattctgc acgtgtacaa ggaccattgc tcaggcttcc tagagacttg
5341 ggctgaacat gctaaacaac ccctgagcct ccattcctac cagggacatc tccagctact
5401 gctcagcttt gtgtgtgaaa tatactggac tgatcctctt tcgggttctg aattggtcct
5461 cacaagcctg gggtccaggg gctgaattgg ctgcatgtgg acaagggtgg gtgttaattc
5521 agggctttga ctagcataag ccccagaaac cagactccct aagcaactgt attgtctccc
5581 cagggccccg agatggcagg attaggctcc aggagtccag acttgtggat acatcctgcc
5641 agcatcactt agcaggtgtc acccagtgcc aaagctgtgt ccaggcagct ggagaggtag
5701 gggtactgac cggccactcc cagaaatcac gtaggtgagt gttgtgtctg acagtcagag
5761 ccagcagcac tccatcccca cccaggggct ccctcctcaa gcttcatcca tttccaggtc
5821 acccctggag gagaagcagt tggaggagga ggattcctct gccacttccg aagaaggagg
5881 aggagggcct ggcccagaag cttcactcaa caagggcctg gccaagcacc tgctgagtgg
5941 tttgggggac cgactctgcc gcctgctgcg gaaggagcgg gaggcccttg cctgggcaca
6001 gcgagaaggt gagccaattt cccttgtggg cctgctcctg catgtccctc ccaacccacg
6061 tttaccagtg ctttggggtt cccaggccta ctcaggagag ctccgtcctt ctttgttcct
6121 agctatccct agcacggact cttggtcaat cctgaggttt ctggcctcct ggggagtcta
6181 aagacttggt ccagtctagt tctctaagaa caactgggct tatggaggaa acagccagtg
6241 ca
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
References

  1.  Cachon-Gonzalez, M. B., San-Jose, I., Cano, A., Vega, J. A., Garcia, N., Freeman, T., Schimmang, T., and Stoye, J. P. (1999) The hairless gene of the mouse: relationship of phenotypic effects with expression profile and genotype, Dev. Dyn. 216, 113-126.

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsXin Du, Bruce Beutler
List |< first << previous [record 37 of 74] next >> last >|
Edit History
2011-01-07 9:22 AM (current)
2010-11-08 11:14 AM
2010-11-08 10:21 AM
2010-11-02 2:56 PM
2010-11-02 2:56 PM
2010-02-03 3:57 PM