Phenotypic Mutation 'Moonpie' (pdf version)
AlleleMoonpie
Mutation Type frame shift
Chromosome15
Coordinate78,481,834 bp (GRCm38)
Base Change TAGTCA ⇒ TAGTCAGTCA (forward strand)
Gene Il2rb
Gene Name interleukin 2 receptor, beta chain
Synonym(s) IL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
Chromosomal Location 78,479,256-78,495,271 bp (-)
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008368; MGI:96550

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000086820 ] [ENSMUSP00000127006 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Probably nonessential (E-score: 0.096) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD8 MFI - decreased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS NK cells - decreased
FACS NK T cells - decreased
Candidate Explorer Status CE: excellent candidate; human score: 1; ML prob: 0.63
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(2) Targeted(8) Transgenic(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78481697 missense probably benign 0.00
flybase UTSW 15 78491848 start codon destroyed probably null 0.66
Whistles UTSW 15 78481936 missense possibly damaging 0.72
R0581:Il2rb UTSW 15 78481936 missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78483987 missense probably damaging 1.00
R1932:Il2rb UTSW 15 78491777 missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78491849 start codon destroyed probably null 0.27
R4706:Il2rb UTSW 15 78486400 missense possibly damaging 0.81
R5713:Il2rb UTSW 15 78491848 start codon destroyed probably null 0.66
R5953:Il2rb UTSW 15 78484982 nonsense probably null
R6018:Il2rb UTSW 15 78482066 missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78481538 missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78481834 frame shift probably null
R6961:Il2rb UTSW 15 78485824 missense probably damaging 1.00
R8020:Il2rb UTSW 15 78485004 missense probably benign
X0018:Il2rb UTSW 15 78485765 missense probably damaging 1.00
X0066:Il2rb UTSW 15 78484956 missense probably benign 0.04
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:27 PM by Anne Murray
Record Created 2019-03-14 8:27 AM by Bruce Beutler
Record Posted 2019-03-21
Phenotypic Description
Figure 1. Moonpie mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Moonpie mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Moonpie mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Moonpie mice exhibit decreased frequencies of peripheral central memory CD8 T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Moonpie mice exhibit decreased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Moonpie mice exhibit decreased frequencies of peripheral NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Moonpie mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Moonpie mice exhibit reduced CD44 expression on peripheral blood CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Moonpie mice exhibit increased IgM expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Moonpie phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6666, some of which showed increased CD4 to CD8 T cell ratios (Figure 1), reduced frequencies of CD8+ T cells (Figure 2), CD8+ T cells in CD3+ T cells (Figure 3), central memory CD8 T cells in CD8 T cells (Figure 4), NK cells (Figure 5), and NK T cells (Figure 6) with concomitant increased frequencies of CD4+ T cells in CD3+ T cells (Figure 7), all in the peripheral blood. Some mice also showed reduced CD44 expression on peripheral blood CD8 T cells (Figure 8) and increased IgM expression on peripheral blood B cells (Figure 9).

Nature of Mutation

Figure 10. Linkage mapping of the reduced NK cell frequency using a semidominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R6666. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Il2rb: a TGACTA ⇒ TGACTGACTA frameshift at base pair 78,481,834 (v38) on chromosome 15, or base pair 29,783 in the GenBank genomic region NC_000081 encoding Il2rb. The strongest association was found with an additive model of inheritance to the normalized NK cell frequency phenotype, wherein four variant homozygotes and nine heterozygous mice departed phenotypically from 16 homozygous reference mice with a P value of 4.607 x 10-13 (Figure 10).   

 

The mutation corresponds to residue 1,406 in the mRNA sequence NM_008368 within exon 10 of 10 total exons.


 

C57BL6J:

1395 GGAGAACAGGATGACTACTGTGCCTTC

416  -G--E--Q--D--D--Y--C--A--F-

 

Moonpie:

1395 GGAGAACAGGATGACTGACTACTGTGCCTTC

416  -G--E--Q--D--D--*-

 

The mutated nucleotide is indicated in red. The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in coding of a premature stop codon after amino acid 420 (the protein is normally 539 amino acids in length) in the CD122 protein.

Protein Prediction

Figure 11. Domain organization of CD122. The location of the Moonpie mutation is indicated. Abbreviations: SP, signal peptide; FN3, fibronectin type-III; TM, transmembrane domain; SS, sorting signal. This image is interactive. Other mutations found in CD122 are noted in red. Click on each muation for more information.

Il2rb encodes CD122 (alternatively, IL2Rβ), the beta chain of the IL-2 receptor (1). The IL-2 receptor has three subunits: α, β (CD122), and γc. The receptors for IL-2, 4, 7, 9, and 15 have a common γ chain, and the receptors for IL-2 and IL-15 share the β chain (2). The β and γc subunits together form an intermediate affinity receptor (3). Upon co-expression of the α subunit, the receptor is converted to a high affinity receptor [PDB:2B5I; (4;5)].  

 

CD122 is a single-pass transmembrane protein, with an extracellular N-terminus and a cytoplasmic C-terminus (Figure 11). Amino acids 1 to 26 are a signal peptide. IL2RB has a single fibronectin type-III domain (FN3; amino acids 135 to 235), a WSXWS motif (amino acids 221 to 225), and a box 1 motif (amino acids 281 to 289). CD122 is cleaved, which generates a 37-kDa fragment (termed 37βic) containing the C-terminal tail and transmembrane domains (6). The CD122 fragment is functional and associates with STAT5 to promote cell proliferation.

 

The Moonpie mutation is predicted to result in coding of a premature stop codon after amino acid 420 in the CD122 protein; Amino acid 420 is within an undefined region in the cytoplasmic C-terminal tail.

 

Please see the record flybase for more information about Il2rb.

Putative Mechanism

IL-2/IL-15 receptor-associated signaling functions in antigen-driven T cell-expansion, and maintains peripheral T cell homeostasis as well as promotes the differentiation and function of NK cells and B cells. Stimulation of the IL-2 receptor (containing a γc subunit) results in activation of JAK3. Activated JAK3 phosphorylates the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT5. Once recruited to the receptor, STAT5 is also tyrosine phosphorylated by JAK3. Phosphorylated, activated STAT5 enters the nucleus and accumulates there to promote transcription.

 

Il2rb-deficient (Il2rb-/-) mice exhibited reduced numbers of regulatory T cells in the thymus and lymph nodes, enlarged spleens, increased sizes of spleen periarteriolar lymphoid sheaths, aberrant T cell responses to inflammatory cytokines, increased percentages of CD4 and CD8 T cells that express high levels of activation markers, reduced T cell proliferation, enlarged lymph nodes, increased levels of anti-DNA antibodies, and increased susceptibility to autoimmune hemolytic anemia (7;8). In addition, Il2rb-/- mice showed reduced numbers of double-positive T cells, B cells, and memory T cells; increased numbers of plasma cells, CD4+ T cells and CD8+ T cells in the thymus, erythroid progenitors in the blood, and neutrophils in the lymph nodes, and increased levels of IgE and IgG1 in the sera (8). Il2rb-/- mice also showed premature death, weight loss, slow movements, fuzzy hair, and poorly developed genitalia (8).

 

The phenotypes observed in the Moonpie mice mimics that of Il2rb-/- mice, indicating loss of CD122-associated function.

Primers PCR Primer
Moonpie_pcr_F: TGATCTTGCCCATGAAGGTTGC
Moonpie_pcr_R: ACCAACCAGGGCTACTTCTTC

Sequencing Primer
Moonpie_seq_F: AAGGTTGCCTTCTGGGACAC
Moonpie_seq_R: AACCAGGGCTACTTCTTCTTCCATC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 440 nucleotides is amplified (chromosome 15, - strand):


1   accaaccagg gctacttctt cttccatctg cccaatgcct tggagatcga atcctgccag
61  gtgtacttca cctatgaccc ctgtgtggaa gaggaggtgg aggaggatgg gtcaaggctg
121 cccgagggat ctccccaccc acctctgctg cctctggctg gagaacagga tgactactgt
181 gccttcccgc ccagggatga cctgctgctc ttctccccga gcctcagcac ccccaacact
241 gcctatgggg gcagcagagc ccctgaagaa agatctccac tctccctgca tgagggactt
301 ccctccctag catcccgtga cctgatgggc ttacagcgcc ctctggagcg gatgccggaa
361 ggtgatggag aggggctgtc tgccaatagc tctggggagc aggccagtgt cccagaaggc
421 aaccttcatg ggcaagatca 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, and Bruce Beutler