Phenotypic Mutation 'six_flags'

• Allele: six_flags
• Mutation Type: missense
• Chromosome: 10
• Coordinate: 28,657,903 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Themis
• Gene Name: thymocyte selection associated
• Synonym(s): Tsepa, Gasp, E430004N04Rik
• Chromosomal Location: 28,544,356-28,759,814 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a protein that plays a regulatory role in both positive and negative T-cell selection during late thymocyte development. The protein functions through T-cell antigen receptor signaling, and is necessary for proper lineage commitment and maturation of T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015] ; PHENOTYPE: Homozygous null mice have defects in T cell positive selection that leads to very few alpha-beta T cells being found in the periphery. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000060129] [ENSMUSP00000055315] [ENSMUSP00000101155] [ENSMUSP00000123919 ^†] [ENSMUSP00000123894] † probably from a misspliced transcript
• AlphaFold: Q8BGW0
• SMART Domains: Protein: ENSMUSP00000060129; Gene: ENSMUSG00000049109; AA Change: I310T

Domain	Start	End	E-Value	Type
Pfam:CABIT	17	266	5.2e-59	PFAM
Pfam:CABIT	282	530	3.7e-48	PFAM
low complexity region	550	564	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000056097)
• SMART Domains: Protein: ENSMUSP00000055315; Gene: ENSMUSG00000049109; AA Change: I310T

Domain	Start	End	E-Value	Type
Pfam:CABIT	17	272	9.3e-52	PFAM
Pfam:CABIT	282	532	5e-62	PFAM
low complexity region	550	564	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000060409)
• SMART Domains: Protein: ENSMUSP00000101155; Gene: ENSMUSG00000049109; AA Change: I310T

Domain	Start	End	E-Value	Type
Pfam:CABIT	17	272	9e-52	PFAM
Pfam:CABIT	282	532	4.9e-62	PFAM
low complexity region	550	564	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000105516)
• SMART Domains: Protein: ENSMUSP00000123919; Gene: ENSMUSG00000049109

Domain	Start	End	E-Value	Type
Pfam:CABIT	17	91	1.9e-10	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000123894; Gene: ENSMUSG00000049109; AA Change: I157T

Domain	Start	End	E-Value	Type
Pfam:CABIT	17	86	1.9e-9	PFAM
Pfam:CABIT	129	203	5.1e-18	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000161345)
• Meta Mutation Damage Score: 0.3811
• Is this an essential gene?: Probably nonessential (E-score: 0.169)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:27 PM by Anne Murray
• Record Created: 2019-03-28 5:46 AM by Bruce Beutler
• Record Posted: 2019-04-02
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_178666; MGI:2443552

Alleles Listed at MGI

All Mutations and Alleles(15) : Chemically induced (ENU)(6) Chemically induce (other) (1) Gene trapped(2) Targeted(6)

Phenotypic Description

Figure 1. Six_flags mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Six_flags mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Six_flags mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Six_flags mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Six_flags mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Six_flags mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Six_flags mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Six_flags mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Six_flags mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Six_flags mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Six_flags mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Six_flags mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Six_flags mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Six_flags mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Six_flags mice exhibit increased frequencies of peripheral NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Six_flags mice exhibit increased CD44 expression on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Six_flags mice exhibit increased CD44 expression on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 18. Six_flags mice exhibit increased CD44 expression on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The six_flags phenotype was identified among G3 mice of the pedigree R6727, some of which showed increased B to T cell ratios (Figure 1) and reduced CD4 to CD8 T cell ratios (Figure 2). The mice also showed reduced frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), CD4+ T cells in CD3+ T cells (Figure 5), CD8+ T cells (Figure 6), naïve CD4 T cells in CD4 T cells (Figure 7), and naïve CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of CD44+ CD8 T cells (Figure 9), CD8+ T cells in CD3+ T cells (Figure 10), central memory CD4 T cells in CD4 T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), effector memory CD4 T cells in CD4 T cells (Figure 13), effector memory CD8 T cells in CD8 T cells (Figure 14), and NK T cells (Figure 15). Expression of CD44 was increased on peripheral blood T cells (Figure 16), CD4+ T cells (Figure 17), and CD8+ T cells (Figure 18).

Nature of Mutation

Figure 19. Linkage mapping of the increased effector memory CD4+ T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 47 mutations (X-axis) identified in the G1 male of pedigree R6727. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 47 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Themis:  a T to C transition at base pair 28,781,907 (v38) on chromosome 10, or base pair 113,581 in the GenBank genomic region NC_000076 encoding Themis. The strongest association was found with a recessive model of inheritance to the increased effector memory CD4 T cell frequency, wherein four variant homozygotes departed phenotypically from 18 homozygous reference mice and 25 heterozygous mice with a P value of 2.677 x 10^-27 (Figure 19).  

The mutation corresponds to residue 1,229 in the mRNA sequence NM_178666 within exon 4 of 6 total exons.

1213 GAGAAAACCATTGTCATCCACAAAAAGTACCAG 305  -E--K--T--I--V--I--H--K--K--Y--Q-

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine to threonine substitution at position 310 (I310T) in the Themis protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 20. Domain structure of Themis. The six_flags mutation (I310T) is shown. Abbreviations: CABIT, cysteine-containing all beta in Themis; NLS, nuclear localization signal; PRR, proline-rich region. See text for more details. This image is interactive; click to view other mutations in Themis.

Themis encodes Thymocyte expressed molecule involved in selection [Themis; alternatively, Grb2-associating protein (Gasp)]. Themis contains two CABIT (cysteine-containing all beta in Themis) domains (amino acids 1-261 (CABIT1) and 262-521 (CABIT2) in Themis), a bipartite nuclear localization signal (NLS; amino acids 345-349 in Themis), and a proline-rich region (PRR; PPPRPPKHP; amino acids 555-563 in Themis) [Figure 20; (1-3)].

The six_flags mutation results in an isoleucine to threonine substitution at position 310 (I310T); Iso310 is within the CABIT2 domain.

For more information about Themis, please see the record for currant.

Putative Mechanism

Themis functions at the positive selection checkpoint in thymocyte development; its mode of action is not known (1-5). Several Themis mutant mouse strains exhibited a block in positive selection, resulting in a block in the developmental progression from DP to SP cells (1-6). As a result, the mutant mice exhibited reduced numbers of thymic and peripheral CD4 and CD8 SP cells; the CD4 SP cells were more affected than the CD8 SP cell population (1-6). The role of Themis in negative selection is unclear. In several mutant mouse studies, minor defects in negative selection were observed along with defects in positive selection (1;4). The function of Themis in TCR signaling has not been resolved. Studies have reported a constitutive association of Themis with TCR signaling proteins including Vav1 (1), Itk, and PLCγ1 (4;6;7). In addition, several studies determined that, upon TCR stimulation, Themis associated with PLCγ1, LAT, and SLP-76 indicating that Themis may be a component of the SLP-76/LAT signalosome (1;4;6-8). Mutations in the noncoding region between THEMIS and PTPRK have been linked to susceptibility to celiac disease in humans (9). In addition, patients with celiac disease exhibit elevated THEMIS levels in the duodenal mucosa compared to unaffected individuals (10). Mice with mutations or deficiency in Themis phenocopy the six_flags mice (1-4;10), suggesting that the six_flags mutation is hypomorphic.  Thymocyte positive selection is likely defective in six_flags mice, as shown for other Themis mutants.

Primers

PCR Primer
six_flags_pcr_F: AGTCCGGATTCTCCCAAGTTTAG
six_flags_pcr_R: ATGGAAAGCTTTGGTGGCC

Sequencing Primer
six_flags_seq_F: CTCCCAAGTTTAGACGTTGAAGTC
six_flags_seq_R: CACCACGTGGAGAGTTTCTTTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 10, + strand):

1   agtccggatt ctcccaagtt tagacgttga agtcaaagat attactgatt cttatgatgc
61  taactggttt cttcagttgc tgtctacgga cgaccttttt gaaatgacca gcaaagagtt
121 tcctgtagta gctgaagttg tcgaaatatc tcaagggaac cacctgcccc aaagtatttt
181 gcagcgagag aaaaccattg tcatccacaa aaagtaccag gcttcgagga tcttagcttc
241 agaaattcgc agcaatttcc ctaaaagaca cttcttgatc cctattagct acaaaggcaa
301 gttcaaaaga agaccacggg agttccccac ggcctatgac ctgcagatag ctaagagcag
361 gaaagaaact ctccacgtgg tggccaccaa agctttccat 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Lesourne, R., Uehara, S., Lee, J., Song, K. D., Li, L., Pinkhasov, J., Zhang, Y., Weng, N. P., Wildt, K. F., Wang, L., Bosselut, R., and Love, P. E. (2009) Themis, a T Cell-Specific Protein Important for Late Thymocyte Development. Nat Immunol. 10, 840-847.

  2. Patrick, M. S., Oda, H., Hayakawa, K., Sato, Y., Eshima, K., Kirikae, T., Iemura, S., Shirai, M., Abe, T., Natsume, T., Sasazuki, T., and Suzuki, H. (2009) Gasp, a Grb2-Associating Protein, is Critical for Positive Selection of Thymocytes. Proc Natl Acad Sci U S A. 106, 16345-16350.

  3. Johnson, A. L., Aravind, L., Shulzhenko, N., Morgun, A., Choi, S. Y., Crockford, T. L., Lambe, T., Domaschenz, H., Kucharska, E. M., Zheng, L., Vinuesa, C. G., Lenardo, M. J., Goodnow, C. C., Cornall, R. J., and Schwartz, R. H. (2009) Themis is a Member of a New Metazoan Gene Family and is Required for the Completion of Thymocyte Positive Selection. Nat Immunol. 10, 831-839.

  4. Fu, G., Vallee, S., Rybakin, V., McGuire, M. V., Ampudia, J., Brockmeyer, C., Salek, M., Fallen, P. R., Hoerter, J. A., Munshi, A., Huang, Y. H., Hu, J., Fox, H. S., Sauer, K., Acuto, O., and Gascoigne, N. R. (2009) Themis Controls Thymocyte Selection through Regulation of T Cell Antigen Receptor-Mediated Signaling. Nat Immunol. 10, 848-856.

  5. Kakugawa, K., Yasuda, T., Miura, I., Kobayashi, A., Fukiage, H., Satoh, R., Matsuda, M., Koseki, H., Wakana, S., Kawamoto, H., and Yoshida, H. (2009) A Novel Gene Essential for the Development of Single Positive Thymocytes. Mol Cell Biol. 29, 5128-5135.

  6. Paster, W., Brockmeyer, C., Fu, G., Simister, P. C., de Wet, B., Martinez-Riano, A., Hoerter, J. A., Feller, S. M., Wulfing, C., Gascoigne, N. R., and Acuto, O. (2013) GRB2-Mediated Recruitment of THEMIS to LAT is Essential for Thymocyte Development. J Immunol. 190, 3749-3756.

  7. Brockmeyer, C., Paster, W., Pepper, D., Tan, C. P., Trudgian, D. C., McGowan, S., Fu, G., Gascoigne, N. R., Acuto, O., and Salek, M. (2011) T Cell Receptor (TCR)-Induced Tyrosine Phosphorylation Dynamics Identifies THEMIS as a New TCR Signalosome Component. J Biol Chem. 286, 7535-7547.

  8. Okada, T., Nitta, T., Kaji, K., Takashima, A., Oda, H., Tamehiro, N., Goto, M., Okamura, T., Patrick, M. S., and Suzuki, H. (2014) Differential Function of Themis CABIT Domains during T Cell Development. PLoS One. 9, e89115.

  9. Dubois, P. C., Trynka, G., Franke, L., Hunt, K. A., Romanos, J., Curtotti, A., Zhernakova, A., Heap, G. A., Adany, R., Aromaa, A., Bardella, M. T., van den Berg, L. H., Bockett, N. A., de la Concha, E. G., Dema, B., Fehrmann, R. S., Fernandez-Arquero, M., Fiatal, S., Grandone, E., Green, P. M., Groen, H. J., Gwilliam, R., Houwen, R. H., Hunt, S. E., Kaukinen, K., Kelleher, D., Korponay-Szabo, I., Kurppa, K., MacMathuna, P., Maki, M., Mazzilli, M. C., McCann, O. T., Mearin, M. L., Mein, C. A., Mirza, M. M., Mistry, V., Mora, B., Morley, K. I., Mulder, C. J., Murray, J. A., Nunez, C., Oosterom, E., Ophoff, R. A., Polanco, I., Peltonen, L., Platteel, M., Rybak, A., Salomaa, V., Schweizer, J. J., Sperandeo, M. P., Tack, G. J., Turner, G., Veldink, J. H., Verbeek, W. H., Weersma, R. K., Wolters, V. M., Urcelay, E., Cukrowska, B., Greco, L., Neuhausen, S. L., McManus, R., Barisani, D., Deloukas, P., Barrett, J. C., Saavalainen, P., Wijmenga, C., and van Heel, D. A. (2010) Multiple Common Variants for Celiac Disease Influencing Immune Gene Expression. Nat Genet. 42, 295-302.

  10. Bondar, C., Plaza-Izurieta, L., Fernandez-Jimenez, N., Irastorza, I., Withoff, S., Wijmenga, C., Chirdo, F., Bilbao, J. R., and CEGEC. (2014) THEMIS and PTPRK in Celiac Intestinal Mucosa: Coexpression in Disease and After in Vitro Gliadin Challenge. Eur J Hum Genet. 22, 358-362.