Phenotypic Mutation 'denuded'

• Allele: denuded
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 71,303,324 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Cd8b1
• Gene Name: CD8 subunit beta 1
• Synonym(s): Ly-3, Ly-C, Lyt-3
• Chromosomal Location: 71,299,772-71,314,476 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. [provided by RefSeq, May 2010] ; PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Glutamine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000070131]
• AlphaFold: P10300
• PDB Structure: Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION] ; Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION] ; Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000070131; Gene: ENSMUSG00000053044; AA Change: L133Q

Domain	Start	End	E-Value	Type
IGv	36	119	2.33e-13	SMART
low complexity region	141	156	N/A	INTRINSIC
transmembrane domain	177	199	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000065248)
• Meta Mutation Damage Score: 0.8996
• Is this an essential gene?: Probably nonessential (E-score: 0.099)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:26 PM by Anne Murray
• Record Created: 2019-04-18 12:56 AM by Bruce Beutler
• Record Posted: 2019-04-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009858; MGI:88347

Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (ENU)(1)  Spontaneous (1) Targeted(3) Transgenic (2)

Phenotypic Description

Figure 1. Denuded mice exhibit an increase in the CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Denuded mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Denuded mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Denuded mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Denuded mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Denuded mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Denuded mice exhibit reduced frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Denuded mice exhibit reduced frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Denuded mice exhibit reduced frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Denuded mice exhibit reduced frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Denuded mice exhibit reduced frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Denuded mice exhibit increased CD44 expression on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Denuded mice exhibit reduced B220 expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The denuded phenotype was identified among G3 mice of the pedigree R6795, some of which showed an increase in the CD4⁺ to CD8⁺ T cell ratio (Figure 1) and an increase in the B to T cell ratio (Figure 2) as well as increased frequencies of CD4⁺ T cells (Figure 3), CD4⁺ T cells in CD3⁺ T cells (Figure 4), central memory CD8 T cells in CD8 T cells (Figure 5), and effector memory CD8 T cells in CD8 T cells (Figure 6) with concomitant reduced frequencies of T cells (Figure 7), CD8⁺ T cells (Figure 8), CD8⁺ T cells in CD3⁺ T cells (Figure 9), CD44⁺ CD8 T cells (Figure 10), and naïve CD8 T cells in CD8 T cells (Figure 11). The expression of CD44 on CD8⁺ T cells (Figure 12) was increased and expression of B220 on peripheral B cells was reduced (Figure 13).

Nature of Mutation

Figure 14. Linkage mapping of the increased CD4 to CD8 T cell ratio using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R6795. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd8b1: a T to A transversion at base pair 71,326,340 (v38) on chromosome 6, or base pair 3,529 in the GenBank genomic region NC_000072 encoding Cd8b1. The strongest association was found with a recessive model of inheritance to the normalized CD4 to CD8 ratio, wherein seven variant homozygotes departed phenotypically from 24 homozygous reference mice and 47 heterozygous mice with a P value of 7.625 x 10^-49 (Figure 14).

The mutation corresponds to residue 467 in the mRNA sequence NM_009858 within exon 2 of 6 total exons.

451 GGGACAGGGACGAAGCTGACTGTGGTTGATGTC 128 -G--T--G--T--K--L--T--V--V--D--V-

The mutated nucleotide is indicated in red. The mutation results in a leucine to glutamine substitution at position 133 (L133Q) in the CD8B1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 15. Domain structure of CD8β. The extracellular region of CD8β has an IgV domain. The denuded mutation results in a leucine to glutamine substitution at position 133 (L133Q). The image is interactive; click on other mutations to view more information.

Cd8b1 encodes CD8β (also known as Lyt-3), a 213-amino acid single pass type I transmembrane glycoprotein of the immunoglobulin (Ig) superfamily (Figure 15) (1). CD8β heterodimerizes with CD8α (also known as Lyt-2; see the record for alfalfa) to form CD8αβ, which functions as a coreceptor for the T cell receptor (TCR) [reviewed in (2)]. The extracellular domain of CD8β increases the avidity of CD8 binding to MHC I (3). The intracellular domain of CD8β promotes the association with Lck and LAT, two proteins required for TCR signal transduction, as well as (4). The intracellular and extracellular domains of CD8β can both independently promote CD8⁺ T cell development, but both domains together is most efficient (3;4). The stalk region of CD8β connects the Ig-like domain to the transmembrane domain. The stalk region of CD8β is essential for selection of CD8⁺ class I MHC-restricted T cells as well as the response of peripheral T cells; the stalk region is not required for expression of CD8β on the cell surface (5). The stalk region enhances the coreceptor function of CD8, making the CD8αβ heterodimer a better coreceptor than CD8αα (6).

Either CD4 (see thoth) or CD8 and the TCR (αβ unless otherwise indicated) mediate T cell recognition of antigen-MHC complexes on the surface of antigen presenting cells. Expression of CD4 versus CD8αβ by a given T cell restricts TCR recognition of peptides to those bound to either MHCII or MHCI, respectively. CD4 and CD8αβ contact a conserved membrane-proximal region of their MHC target to enforce MHC class restriction. Three complementarity-determining regions (CDRs), consisting of the BC loop (CDR1), the C’C” loop (CDR2), and the FG loop (CDR3), are involved in binding to the α3 domain of pMHCI. Residues in the CDR1 (Lys23), CDR2 (Lys55), and CDR3 (Val99, Ser101, and Lys103) loops of CD8β decreased MHC I binding and T cell activation (7).

The denuded mutation results in a leucine to glutamine substitution at position 133 (L133Q); Leu133 is within the extracellular IgV domain.

Please see the record Carlsbad for more information about Cd8b1.

Putative Mechanism

T cells become activated when the TCR engages a peptide antigen in complex with an MHC molecule on the surface of a target or antigen-presenting cell. Engagement of pMHC by the TCR and either the CD4 or CD8 coreceptor is necessary for optimal T cell stimulation (8;9). For cytotoxic T cells, the interaction of CD8 with MCHI enhances the antigen sensitivity and response of the T cells to pMHC ligands (10). Absent CD8-pMHCI interaction, MHC class I-restricted immune responses including cytokine production and cytotoxic effector function are impaired (8;9). Rather than physically promoting initial TCR-pMHCI binding, the major function of CD8αβ is to recruit the kinase Lck to the TCR-MHC interaction site where it can phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMs) on the cytoplasmic tails of associated CD3 proteins (see tumormouse, a mutation of Cd3e, and allia, a mutation of Cd247) (11;12). Their phosphorylation recruits and activates other proteins including ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock), SLP-76 (SH2 domain-containing leukocyte protein of 76 kDa), and LAT (linker for activation of T cells) necessary for signaling leading to T cell activation, proliferation. The CD8-pMHCI interaction synergistically stabilizes TCR-pMHCI interactions (13). However, it has also been reported that CD8αβ can play a critical role in promoting TCR-pMHCI binding, particularly for multimeric low-affinity pMHCI ligands (14;15).

TCR signaling is necessary for both adaptive immune responses and for thymocyte differentiation. CD8αβ is required for both positive and negative selection of double positive cells in the thymus (16-18). Cd8b1-deficient mice exhibited a five-fold reduction in the numbers of CD8+ T cells in the thymus and the periphery; the CD8+ T cells that remained had normal cytotoxic T lymphocyte activity (16-19). CD8α expression on thymocytes and peripheral T cells was reduced compared to that in wild-type mice (19). The population size and CD8α expression was normal in intraepithelial lymphocytes from the Cd8b1-deficient mice due to the predominant expression of CD8αα homodimers on these cells (19). Peripheral T cells from the Cd8b1-deficient mice did not exhibit defective cytotoxic activity against lymphocytic choriomeningitis virus or vesicular stomatitis virus (19-21).

The phenotypes observed in the denuded mice indicate loss of CD8β-associated function.

Primers

PCR Primer
denuded_pcr_F: CCAAGGACAAGTACTTTGAGTTCC
denuded_pcr_R: TCACTGAGAGTAGGCAGCTC

Sequencing Primer
denuded_seq_F: GACAAGTACTTTGAGTTCCTGGCC
denuded_seq_R: CTGAGAGTAGGCAGCTCCAGTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 412 nucleotides is amplified (chromosome 6, + strand):

1   ccaaggacaa gtactttgag ttcctggcct cctggagttc ttccaaagga gttttgtatg
61  gtgaaagtgt ggacaagaaa agaaatataa ttcttgagtc ttcagactca agacggccct
121 ttctcagtat catgaatgtg aagccagagg acagtgactt ctacttctgc gcgacggttg
181 ggagccccaa gatggtcttt gggacaggga cgaagctgac tgtgggtaag aatgttctca
241 aggctgtgaa tgagcacaca cacacacaca tgtacacaca tgtgcgcaca cacatacaca
301 cacatgcttg ttcatacaga tgtacactca catgcacaca tacacatgtg attgcacaca
361 tatgcacaca cacactctca caccgggcac tggagctgcc tactctcagt ga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Nakauchi, H., Shinkai, Y., and Okumura, K. (1987) Molecular Cloning of Lyt-3, a Membrane Glycoprotein Marking a Subset of Mouse T Lymphocytes: Molecular Homology to Immunoglobulin and T-Cell Receptor Variable and Joining Regions. Proc Natl Acad Sci U S A. 84, 4210-4214.

  2. Li, Y., Yin, Y., and Mariuzza, R. A. (2013) Structural and Biophysical Insights into the Role of CD4 and CD8 in T Cell Activation. Front Immunol. 4, 206.

  3. Bosselut, R., Kubo, S., Guinter, T., Kopacz, J. L., Altman, J. D., Feigenbaum, L., and Singer, A. (2000) Role of CD8beta Domains in CD8 Coreceptor Function: Importance for MHC I Binding, Signaling, and Positive Selection of CD8+ T Cells in the Thymus. Immunity. 12, 409-418.

  4. Irie, H. Y., Mong, M. S., Itano, A., Crooks, M. E., Littman, D. R., Burakoff, S. J., and Robey, E. (1998) The Cytoplasmic Domain of CD8 Beta Regulates Lck Kinase Activation and CD8 T Cell Development. J Immunol. 161, 183-191.

  5. Rettig, L., McNeill, L., Sarner, N., Guillaume, P., Luescher, I., Tolaini, M., Kioussis, D., and Zamoyska, R. (2009) An Essential Role for the Stalk Region of CD8 Beta in the Coreceptor Function of CD8. J Immunol. 182, 121-129.

  6. Wong, J. S., Wang, X., Witte, T., Nie, L., Carvou, N., Kern, P., and Chang, H. C. (2003) Stalk Region of Beta-Chain Enhances the Coreceptor Function of CD8. J Immunol. 171, 867-874.

  7. Devine, L., Thakral, D., Nag, S., Dobbins, J., Hodsdon, M. E., and Kavathas, P. B. (2006) Mapping the Binding Site on CD8 Beta for MHC Class I Reveals Mutants with Enhanced Binding. J Immunol. 177, 3930-3938.

  8. Connolly, J. M., Hansen, T. H., Ingold, A. L., and Potter, T. A. (1990) Recognition by CD8 on Cytotoxic T Lymphocytes is Ablated by several Substitutions in the Class I Alpha 3 Domain: CD8 and the T-Cell Receptor Recognize the Same Class I Molecule. Proc Natl Acad Sci U S A. 87, 2137-2141.

  9. Salter, R. D., Benjamin, R. J., Wesley, P. K., Buxton, S. E., Garrett, T. P., Clayberger, C., Krensky, A. M., Norment, A. M., Littman, D. R., and Parham, P. (1990) A Binding Site for the T-Cell Co-Receptor CD8 on the Alpha 3 Domain of HLA-A2. Nature. 345, 41-46.

  10. Holler, P. D., and Kranz, D. M. (2003) Quantitative Analysis of the Contribution of TCR/pepMHC Affinity and CD8 to T Cell Activation. Immunity. 18, 255-264.

  11. Artyomov, M. N., Lis, M., Devadas, S., Davis, M. M., and Chakraborty, A. K. (2010) CD4 and CD8 Binding to MHC Molecules Primarily Acts to Enhance Lck Delivery. Proc Natl Acad Sci U S A. 107, 16916-16921.

  12. Purbhoo, M. A., Boulter, J. M., Price, D. A., Vuidepot, A. L., Hourigan, C. S., Dunbar, P. R., Olson, K., Dawson, S. J., Phillips, R. E., Jakobsen, B. K., Bell, J. I., and Sewell, A. K. (2001) The Human CD8 Coreceptor Effects Cytotoxic T Cell Activation and Antigen Sensitivity Primarily by Mediating Complete Phosphorylation of the T Cell Receptor Zeta Chain. J Biol Chem. 276, 32786-32792.

  13. Jiang, N., Huang, J., Edwards, L. J., Liu, B., Zhang, Y., Beal, C. D., Evavold, B. D., and Zhu, C. (2011) Two-Stage Cooperative T Cell Receptor-Peptide Major Histocompatibility Complex-CD8 Trimolecular Interactions Amplify Antigen Discrimination. Immunity. 34, 13-23.

  14. Daniels, M. A., and Jameson, S. C. (2000) Critical Role for CD8 in T Cell Receptor Binding and Activation by peptide/major Histocompatibility Complex Multimers. J Exp Med. 191, 335-346.

  15. Denkberg, G., Cohen, C. J., and Reiter, Y. (2001) Critical Role for CD8 in Binding of MHC Tetramers to TCR: CD8 Antibodies Block Specific Binding of Human Tumor-Specific MHC-Peptide Tetramers to TCR. J Immunol. 167, 270-276.

  16. Fung-Leung, W. P., Schilham, M. W., Rahemtulla, A., Kundig, T. M., Vollenweider, M., Potter, J., van Ewijk, W., and Mak, T. W. (1991) CD8 is Needed for Development of Cytotoxic T Cells but Not Helper T Cells. Cell. 65, 443-449.

  17. Crooks, M. E., and Littman, D. R. (1994) Disruption of T Lymphocyte Positive and Negative Selection in Mice Lacking the CD8 Beta Chain. Immunity. 1, 277-285.

  18. Nakayama, K., Nakayama, K., Negishi, I., Kuida, K., Louie, M. C., Kanagawa, O., Nakauchi, H., and Loh, D. Y. (1994) Requirement for CD8 Beta Chain in Positive Selection of CD8-Lineage T Cells. Science. 263, 1131-1133.

  19. Fung-Leung, W. P., Kundig, T. M., Ngo, K., Panakos, J., De Sousa-Hitzler, J., Wang, E., Ohashi, P. S., Mak, T. W., and Lau, C. Y. (1994) Reduced Thymic Maturation but Normal Effector Function of CD8+ T Cells in CD8 Beta Gene-Targeted Mice. J Exp Med. 180, 959-967.

  20. Angelov, G. S., Guillaume, P., and Luescher, I. F. (2009) CD8beta Knockout Mice Mount Normal Anti-Viral CD8+ T Cell Responses--but Why? Int Immunol. 21, 123-135.

  21. Fung-Leung, W. P., Kundig, T. M., Zinkernagel, R. M., and Mak, T. W. (1991) Immune Response Against Lymphocytic Choriomeningitis Virus Infection in Mice without CD8 Expression. J Exp Med. 174, 1425-1429.