Phenotypic Mutation 'warts_and_all'

• Allele: warts_and_all
• Mutation Type: critical splice donor site (2 bp from exon)
• Chromosome: 19
• Coordinate: 25,169,501 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Dock8
• Gene Name: dedicator of cytokinesis 8
• Synonym(s): A130095G14Rik, 5830472H07Rik, 1200017A24Rik
• Chromosomal Location: 24,999,529-25,202,432 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010] ; PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025831 ^†] † probably from a misspliced transcript
• AlphaFold: Q8C147
• PDB Structure: Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000025831; Gene: ENSMUSG00000052085

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9594
• Is this an essential gene?: Probably nonessential (E-score: 0.087)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:26 PM by Diantha La Vine
• Record Created: 2019-05-02 10:59 AM by Bruce Beutler
• Record Posted: 2019-05-13
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_028785; MGI:1921396

Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (ENU)(7) Endonuclease-mediated(2) Gene trapped(4) Spontaneous(2) Targeted(4)

Phenotypic Description

Figure 1. Warts_and_all mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Warts_and_all mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Warts_and_all mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Warts_and_all mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Warts_and_all mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Warts_and_all mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Warts_and_all mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Warts_and_all mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Warts_and_all mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Warts_and_all mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Warts_and_all mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Warts_and_all mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Warts_and_all mice exhibit increased CD44 expression on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Warts_and_all mice exhibit increased CD44 expression on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Warts_and_all mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Warts_and_all mice exhibit reduced B220 expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The warts_and_all phenotype was identified among G3 mice of the pedigree R6818, some of which showed increased B to T cell ratios (Figure 1) as well as reduced frequencies of B1 cells (Figure 2), T cells (Figure 3), CD4+ T cells (Figure 4), CD8+ T cells (Figure 5), naïve CD4 T cells in CD4 T cells (Figure 6), and naïve CD8 T cells in CD8 T cells (Figure 7) with concomitant increased frequencies of CD44+ CD4 T cells (Figure 8), central memory CD4 T cells in CD4 T cells (Figure 9), central memory CD8 T cells in CD8 T cells (Figure 10), effector memory CD4 T cells in CD4 T cells (Figure 11), and effector memory CD8 T cells in CD8 T cells (Figure 12), all in the peripheral blood. The expression of CD44 on peripheral blood T cells (Figure 13), CD4+ T cells (Figure 14), and CD8+ T cells (Figure 15) was increased. The expression of B220 on peripheral blood B cells was reduced (Figure 16).

Nature of Mutation

Figure 17. Linkage mapping of the reduced T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R6818. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Dock8: a T to C transition at base pair 25,169,501 (v38) on chromosome 19, or base pair 16,9991 in the GenBank genomic region NC_000085 in the splice donor site of intron 34, two-base pairs from exon 34. The strongest association was found with a recessive model of inheritance to the reduced T cell frequency phenotype, wherein six variant homozygotes departed phenotypically from 12 homozygous reference mice and eight heterozygous mice with a P value of 1.241 x 10^-9 (Figure 17).

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 97-base pair exon 34 (out of 48 total exons). The mutation would cause a frame-shifted protein product beginning after amino acid 1,415 of the protein, which is normally 2,100 amino acids in length, and termination after the inclusion of 19 aberrant amino acids.

<--exon 33     <--exon 34 intron 34-->         exon 35--> 4356 ……AAGCTGGACAA ……AACATCATCCAG gtgaggatgactcactcc…… GCAAGCTCCG……GGGTCCTGGTGA 1412 ……-K--L--D--K ……-N--I--I--Q-                      --Q--A--P-……-G--S--W--*-          correct       deleted                                 aberrant

The donor splice site of intron 34, which is destroyed by the warts_and_all mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 18. Domain structure of DOCK8, a member of the DOCKC subfamily. DHR-1 domain shares a weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac and/or Cdc42. The warts_and_all mutation is indicated. Click on the other DOCK8 mutations for more specific information about those mutations.

DOCK8 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases (1-4). The DOCK C subfamily (which includes DOCK8 and DOCK7; see the record for moonlight) has dual specificity for Rac and Cdc42 (1;3;5;6).  Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain and the DHR-1 or CZH-1 domain (Figure 18).  The DHR-1 domain is located N-terminal to the DHR-2 domain (2;4).

The warts_and_all mutation results in abnormal splicing of Dock8 causing deletion of exon 34, which encodes amino acids 1,416 to 1,447 within the DHR-2 domain.

Please see the record for captain morgan for more information about Dock8.

Putative Mechanism

The Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction. Like DOCK2, DOCK8 is likely to regulate the activity of GTPases and thus be involved in cytoskeletal changes associated with various cellular processes. DOCK8 is proposed to serve as an effector downstream of CD19 and PI3K to promote G protein signaling events critical for integrin polarization at the synapse and for the survival of marginal zone B cells and germinal center (GC) B cells. 

During a T cell-dependent humoral immune response, CD4⁺ T helper cell subsets including T_FH, Th1 and Th2 cells migrate to the T cell/B cell borders in SLO, and interact with cognate antigen-specific B cells through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand (see the record for walla).  This interaction results in the secretion by T helper cells of certain cytokines known to promote B cell survival, proliferation, and antibody production (7;8).

In humans, DOCK8 deficiency results in an autosomal recessive form of hyper-IgE recurrent infection syndrome (HIES; OMIM #243700) (9;10).  Autosomal dominant HIES is characterized by recurrent Staphylococcus aureus skin abscesses, increased serum IgE, and abnormalities of the connective tissue, skeleton, and dentition (11).  The autosomal recessive form shares hyper-IgE, eosinophilia, and recurrent Staphylococcal infections, but is distinguished from autosomal dominant HIES by the lack of connective tissue and skeletal involvement (12). Patients with DOCK8 deficiency are unusually susceptible to viral infections and virally-caused cancers.  Reduced numbers of T, B, and NK cells have been reported along with a selective defect in CD8⁺ T cell activation (9).  However, another study suggests most patients have normal numbers of B and NK cells, a greater decrease in the CD4⁺ T cell population than the CD8⁺ T cell population, and a more comprehensive T cell activation defect involving both T cell subsets (10).  Both autosomal dominant and autosomal recessive HIES are linked to a lack of Th17 cell function including the failure to produce the interleukin 17 (IL-17) cytokine (12).  Th17 are a subset of CD4⁺ T helper cells that play an important role in the development of autoimmune diseases like rheumatoid arthritis, as well as being critical in the clearance of fungal and extracellular bacterial infections (13).    

The relatively normal initiation of antibody production by mice with Dock8 mutations suggests that the extrafollicular B cell clonal expansion, plasma cell formation and immunoglobulin class switching, which depends on interactions with T helper cells, is intact.  However, subsequent antibody responses and affinity maturation occurring in the GCs is significantly impaired. The humoral deficits are due to a defect in GC B cell survival and selection during the affinity maturation phase of GC responses (14).

Primers

PCR Primer
warts_and_all_pcr_F: GGGTTGTCATCTCTGGTACC
warts_and_all_pcr_R: GGGTCAGCTCCTCAAACATC

Sequencing Primer
warts_and_all_seq_F: ATCTCTGGTACCTGGCCGAG
warts_and_all_seq_R: ACTCTTTCCAAGGGAGTAGCAGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 409 nucleotides is amplified (chromosome 19, + strand):

1   gggttgtcat ctctggtacc tggccgagcc acacaatgct ttaatgggtg atgtgctttt
61  tgtttcttag aacaaaggca gagttagatc aagaagcctt gatcagtggc aacctggcta
121 cagaagctaa tttgatcatc ctggatatgc aggagaacat catccaggtg aggatgactc
181 actccccatc gggcccgctc gggggtgcca ttcttggaaa tagaaagggg gttcgtcatc
241 caaaattgaa aaagacacag gcgtgattct agaatgtata aaactaaagt gggaacgttt
301 ggaatttgca gcagttgcct cccttgcaga ttccagaggt gccaggcatc ctctggcttt
361 tctgactgct actcccttgg aaagagttag atgtttgagg agctgaccc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Cote, J. F., and Vuori, K. (2002) Identification of an Evolutionarily Conserved Superfamily of DOCK180-Related Proteins with Guanine Nucleotide Exchange Activity. J Cell Sci. 115, 4901-4913.

  2. Cote, J. F., and Vuori, K. (2007) GEF what? Dock180 and Related Proteins Help Rac to Polarize Cells in New Ways. Trends Cell Biol. 17, 383-393.

  3. Meller, N., Irani-Tehrani, M., Kiosses, W. B., Del Pozo, M. A., and Schwartz, M. A. (2002) Zizimin1, a Novel Cdc42 Activator, Reveals a New GEF Domain for Rho Proteins. Nat Cell Biol. 4, 639-647.

  4. Meller, N., Irani-Tehrani, M., Ratnikov, B. I., Paschal, B. M., and Schwartz, M. A. (2004) The Novel Cdc42 Guanine Nucleotide Exchange Factor, zizimin1, Dimerizes Via the Cdc42-Binding CZH2 Domain. J Biol Chem. 279, 37470-37476.

  5. Brugnera, E., Haney, L., Grimsley, C., Lu, M., Walk, S. F., Tosello-Trampont, A. C., Macara, I. G., Madhani, H., Fink, G. R., and Ravichandran, K. S. (2002) Unconventional Rac-GEF Activity is Mediated through the Dock180-ELMO Complex. Nat Cell Biol. 4, 574-582.

  6. Miyamoto, Y., Yamauchi, J., Sanbe, A., and Tanoue, A. (2007) Dock6, a Dock-C Subfamily Guanine Nucleotide Exchanger, has the Dual Specificity for Rac1 and Cdc42 and Regulates Neurite Outgrowth. Exp Cell Res. 313, 791-804.

  7. MacLennan, I. C., Toellner, K. M., Cunningham, A. F., Serre, K., Sze, D. M., Zuniga, E., Cook, M. C., and Vinuesa, C. G. (2003) Extrafollicular Antibody Responses. Immunol Rev. 194, 8-18.

  8. King, C., Tangye, S. G., and Mackay, C. R. (2008) T Follicular Helper (TFH) Cells in Normal and Dysregulated Immune Responses. Annu Rev Immunol. 26, 741-766.

  9. Zhang, Q., Davis, J. C., Lamborn, I. T., Freeman, A. F., Jing, H., Favreau, A. J., Matthews, H. F., Davis, J., Turner, M. L., Uzel, G., Holland, S. M., and Su, H. C. (2009) Combined Immunodeficiency Associated with DOCK8 Mutations. N Engl J Med. 361, 2046-2055.

  10. Engelhardt, K. R., McGhee, S., Winkler, S., Sassi, A., Woellner, C., Lopez-Herrera, G., Chen, A., Kim, H. S., Lloret, M. G., Schulze, I., Ehl, S., Thiel, J., Pfeifer, D., Veelken, H., Niehues, T., Siepermann, K., Weinspach, S., Reisli, I., Keles, S., Genel, F., Kutukculer, N., Camcioglu, Y., Somer, A., Karakoc-Aydiner, E., Barlan, I., Gennery, A., Metin, A., Degerliyurt, A., Pietrogrande, M. C., Yeganeh, M., Baz, Z., Al-Tamemi, S., Klein, C., Puck, J. M., Holland, S. M., McCabe, E. R., Grimbacher, B., and Chatila, T. A. (2009) Large Deletions and Point Mutations Involving the Dedicator of Cytokinesis 8 (DOCK8) in the Autosomal-Recessive Form of Hyper-IgE Syndrome. J Allergy Clin Immunol. 124, 1289-302.e4.

  11. Grimbacher, B., Holland, S. M., Gallin, J. I., Greenberg, F., Hill, S. C., Malech, H. L., Miller, J. A., O'Connell, A. C., and Puck, J. M. (1999) Hyper-IgE Syndrome with Recurrent Infections--an Autosomal Dominant Multisystem Disorder. N Engl J Med. 340, 692-702.

  12. Renner, E. D., Puck, J. M., Holland, S. M., Schmitt, M., Weiss, M., Frosch, M., Bergmann, M., Davis, J., Belohradsky, B. H., and Grimbacher, B. (2004) Autosomal Recessive Hyperimmunoglobulin E Syndrome: A Distinct Disease Entity. J Pediatr. 144, 93-99.

  13. Weaver, C. T., Hatton, R. D., Mangan, P. R., and Harrington, L. E. (2007) IL-17 Family Cytokines and the Expanding Diversity of Effector T Cell Lineages. Annu Rev Immunol. 25, 821-852.

  14. Randall, K. L., Lambe, T., Johnson, A. L., Treanor, B., Kucharska, E., Domaschenz, H., Whittle, B., Tze, L. E., Enders, A., Crockford, T. L., Bouriez-Jones, T., Alston, D., Cyster, J. G., Lenardo, M. J., Mackay, F., Deenick, E. K., Tangye, S. G., Chan, T. D., Camidge, T., Brink, R., Vinuesa, C. G., Batista, F. D., Cornall, R. J., and Goodnow, C. C. (2009) Dock8 Mutations Cripple B Cell Immunological Synapses, Germinal Centers and Long-Lived Antibody Production. Nat Immunol. 10, 1283-1291.