Phenotypic Mutation 'warts_and_all' (pdf version)
Allelewarts_and_all
Mutation Type critical splice donor site (2 bp from exon)
Chromosome19
Coordinate25,169,501 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Dock8
Gene Name dedicator of cytokinesis 8
Synonym(s) A130095G14Rik, 5830472H07Rik, 1200017A24Rik
Chromosomal Location 24,999,529-25,202,432 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_028785; MGI:1921396

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025831 ]   † probably from a misspliced transcript
PDB Structure
Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Predicted Effect probably null
Meta Mutation Damage Score 0.9594 question?
Is this an essential gene? Probably nonessential (E-score: 0.097) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1 cells - decreased
FACS B220 MFI - decreased
FACS CD4+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased
Candidate Explorer Status CE: excellent candidate; human score: 1.5; ML prob: 0.708
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (ENU)(7) Endonuclease-mediated(2) Gene trapped(4) Spontaneous(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R7942:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7947:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R7980:Dock8 UTSW 19 25131933 intron probably null
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:26 PM by Diantha La Vine
Record Created 2019-05-02 10:59 AM by Bruce Beutler
Record Posted 2019-05-13
Phenotypic Description
Figure 1. Warts_and_all mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Warts_and_all mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Warts_and_all mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Warts_and_all mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Warts_and_all mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Warts_and_all mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Warts_and_all mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Warts_and_all mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Warts_and_all mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Warts_and_all mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Warts_and_all mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Warts_and_all mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Warts_and_all mice exhibit increased CD44 expression on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Warts_and_all mice exhibit increased CD44 expression on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Warts_and_all mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Warts_and_all mice exhibit reduced B220 expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The warts_and_all phenotype was identified among G3 mice of the pedigree R6818, some of which showed increased B to T cell ratios (Figure 1) as well as reduced frequencies of B1 cells (Figure 2), T cells (Figure 3), CD4+ T cells (Figure 4), CD8+ T cells (Figure 5), naïve CD4 T cells in CD4 T cells (Figure 6), and naïve CD8 T cells in CD8 T cells (Figure 7) with concomitant increased frequencies of CD44+ CD4 T cells (Figure 8), central memory CD4 T cells in CD4 T cells (Figure 9), central memory CD8 T cells in CD8 T cells (Figure 10), effector memory CD4 T cells in CD4 T cells (Figure 11), and effector memory CD8 T cells in CD8 T cells (Figure 12), all in the peripheral blood. The expression of CD44 on peripheral blood T cells (Figure 13), CD4+ T cells (Figure 14), and CD8+ T cells (Figure 15) was increased. The expression of B220 on peripheral blood B cells was reduced (Figure 16).

Nature of Mutation

Figure 17. Linkage mapping of the reduced T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R6818. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Dock8: a T to C transition at base pair 25,169,501 (v38) on chromosome 19, or base pair 16,9991 in the GenBank genomic region NC_000085 in the splice donor site of intron 34, two-base pairs from exon 34. The strongest association was found with a recessive model of inheritance to the reduced T cell frequency phenotype, wherein six variant homozygotes departed phenotypically from 12 homozygous reference mice and eight heterozygous mice with a P value of 1.241 x 10-9 (Figure 17).

 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 97-base pair exon 34 (out of 48 total exons). The mutation would cause a frame-shifted protein product beginning after amino acid 1,415 of the protein, which is normally 2,100 amino acids in length, and termination after the inclusion of 19 aberrant amino acids.

 

        <--exon 33     <--exon 34 intron 34-->         exon 35-->
4356 ……AAGCTGGACAA ……AACATCATCCAG gtgaggatgactcactcc…… GCAAGCTCCG……GGGTCCTGGTGA
1412 ……-K--L--D--K ……-N--I--I--Q-                      --Q--A--P-……-G--S--W--*-
         correct       deleted                                 aberrant

 

The donor splice site of intron 34, which is destroyed by the warts_and_all mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 18. Domain structure of DOCK8, a member of the DOCKC subfamily. DHR-1 domain shares a weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac and/or Cdc42. The warts_and_all mutation is indicated. Click on the other DOCK8 mutations for more specific information about those mutations.

DOCK8 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases (1-4). The DOCK C subfamily (which includes DOCK8 and DOCK7; see the record for moonlight) has dual specificity for Rac and Cdc42 (1;3;5;6).  Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain and the DHR-1 or CZH-1 domain (Figure 18).  The DHR-1 domain is located N-terminal to the DHR-2 domain (2;4).

 

The warts_and_all mutation results in abnormal splicing of Dock8 causing deletion of exon 34, which encodes amino acids 1,416 to 1,447 within the DHR-2 domain.

 

Please see the record for captain morgan for more information about Dock8.

Putative Mechanism

The Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction. Like DOCK2, DOCK8 is likely to regulate the activity of GTPases and thus be involved in cytoskeletal changes associated with various cellular processes. DOCK8 is proposed to serve as an effector downstream of CD19 and PI3K to promote G protein signaling events critical for integrin polarization at the synapse and for the survival of marginal zone B cells and germinal center (GC) B cells. 

 

During a T cell-dependent humoral immune response, CD4+ T helper cell subsets including TFH, Th1 and Th2 cells migrate to the T cell/B cell borders in SLO, and interact with cognate antigen-specific B cells through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand (see the record for walla).  This interaction results in the secretion by T helper cells of certain cytokines known to promote B cell survival, proliferation, and antibody production (7;8).

 

In humans, DOCK8 deficiency results in an autosomal recessive form of hyper-IgE recurrent infection syndrome (HIES; OMIM #243700) (9;10).  Autosomal dominant HIES is characterized by recurrent Staphylococcus aureus skin abscesses, increased serum IgE, and abnormalities of the connective tissue, skeleton, and dentition (11).  The autosomal recessive form shares hyper-IgE, eosinophilia, and recurrent Staphylococcal infections, but is distinguished from autosomal dominant HIES by the lack of connective tissue and skeletal involvement (12). Patients with DOCK8 deficiency are unusually susceptible to viral infections and virally-caused cancers.  Reduced numbers of T, B, and NK cells have been reported along with a selective defect in CD8+ T cell activation (9).  However, another study suggests most patients have normal numbers of B and NK cells, a greater decrease in the CD4+ T cell population than the CD8+ T cell population, and a more comprehensive T cell activation defect involving both T cell subsets (10).  Both autosomal dominant and autosomal recessive HIES are linked to a lack of Th17 cell function including the failure to produce the interleukin 17 (IL-17) cytokine (12).  Th17 are a subset of CD4+ T helper cells that play an important role in the development of autoimmune diseases like rheumatoid arthritis, as well as being critical in the clearance of fungal and extracellular bacterial infections (13).    

 

The relatively normal initiation of antibody production by mice with Dock8 mutations suggests that the extrafollicular B cell clonal expansion, plasma cell formation and immunoglobulin class switching, which depends on interactions with T helper cells, is intact.  However, subsequent antibody responses and affinity maturation occurring in the GCs is significantly impaired. The humoral deficits are due to a defect in GC B cell survival and selection during the affinity maturation phase of GC responses (14).

Primers PCR Primer
warts_and_all_pcr_F: GGGTTGTCATCTCTGGTACC
warts_and_all_pcr_R: GGGTCAGCTCCTCAAACATC

Sequencing Primer
warts_and_all_seq_F: ATCTCTGGTACCTGGCCGAG
warts_and_all_seq_R: ACTCTTTCCAAGGGAGTAGCAGTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 409 nucleotides is amplified (chromosome 19, + strand):


1   gggttgtcat ctctggtacc tggccgagcc acacaatgct ttaatgggtg atgtgctttt
61  tgtttcttag aacaaaggca gagttagatc aagaagcctt gatcagtggc aacctggcta
121 cagaagctaa tttgatcatc ctggatatgc aggagaacat catccaggtg aggatgactc
181 actccccatc gggcccgctc gggggtgcca ttcttggaaa tagaaagggg gttcgtcatc
241 caaaattgaa aaagacacag gcgtgattct agaatgtata aaactaaagt gggaacgttt
301 ggaatttgca gcagttgcct cccttgcaga ttccagaggt gccaggcatc ctctggcttt
361 tctgactgct actcccttgg aaagagttag atgtttgagg agctgaccc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, and Bruce Beutler