Phenotypic Mutation 'odd' (pdf version)
Alleleodd
Mutation Type splice site (5 bp from exon)
Chromosome4
Coordinate101,728,075 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Lepr
Gene Name leptin receptor
Synonym(s) obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
Chromosomal Location 101,717,404-101,815,352 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_146146, NM_010704; MGI: 104993

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
Predicted Effect probably benign
Meta Mutation Damage Score Not available question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
adipose tissue
behavior/neurological
Body Weight - increased
growth/size
homeostasis/metabolism
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI
All alleles(36) : Targeted, knock-out(3) Targeted, other(12) Transgenic(1) Spontaneous(13) Chemically induced(7)  
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository

none

Last Updated 2019-03-30 7:48 AM by Diantha La Vine
Record Created 2009-09-02 12:00 AM
Record Posted 2009-10-19
Phenotypic Description

The odd mutation was identified in ENU-mutagenized G3 mice, and is characterized by excessive body weight (Figure 1).

Nature of Mutation
The odd mutation mapped to Chromosome 4, and corresponds to a G to T transversion in the donor splice site of intron 2 (GTAAGT -> GTAATT) of the Lepr gene (position 10636 in Genbank genomic region NC_000070  for linear genomic DNA sequence of Lepr). The effect of the mutation at the cDNA and protein level has not been tested, but impairment of splicing may result in skipping of the first coding exon, exon 2 and removal of the normal ATG start site. An alternative ATG is present in exon 3. Use of this start would frame-shift the protein and result in immediate truncation following the methionine start site. 
 
         <--exon 1   <--exon 2 intron 2-->  exon 3-->
492 CAAATCCAG……TTACACTGGGGTAAGTGGC……………AATTTCTTTATGTGA 15843
11             -L--H--W-                        -M--*         
                deleted                        aberrant
 
The donor splice site of intron 2, which is destroyed by the odd mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering
Protein Prediction
Figure 2. Domain of OB-Rb and structure of mouse leptin receptor isoforms. OB-Rb contains the longest intracellular domain, which is crucial for leptin signaling. OB-Ra, OB-Rc and OB-Rd have varying short cytoplasmic domains. All isoforms contain the Box 1 motif known to bind JAK kinases. OB-Re is a secreted isoform of the leptin receptor. Cytokine receptor homology module (CRH)2 is the main binding site for leptin. The immunoglobin-like (IG-like) and fibronectin type III (FNIII) domains are involved in OB-R activation. The role of CRH1 remains to be determined. Both CRH domains also contain a FNIII fold (see text). The odd mutation corresponds to a G to T transversion in the donor splice site of intron 2 of the Lepr gene. This image is interactive. Other mutations found in the Lepr gene are noted in red. Click on the mutations for more specific information. 
The odd mutation likely results in aberrant splicing of Lepr transcript, which may remove the normal ATG start site and result in complete absence of protein. The effect of the mutation at the protein level is unknown (Figure 2).
 
Please see the record for Business class for more information on Lepr.
Primers Primers cannot be located by automatic search.
Genotyping
Odd genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Odd(F): 5’- CCCACAGTAATGGAGACCCTCCACTATATAAATACTCTGC -3’
Odd(R): 5’- TGGGACCACAAAGTACCAGGTATCAGTCAACATAAAG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Odd_seq(F): 5'- TTTCTATAGACTGCCAGTACATATGA -3'
Odd_seq(R): 5’- GGTATCAGTCAACATAAAGTTCCTC -3’
 
The following sequence of 807 nucleotides (from Genbank genomic region NC_000070 for linear DNA sequence of Lepr) is amplified:
 
 9927                             ccca cagtaatgga gaccctccac tatataaata
 9961 ctctgcttaa tatactacac tacacacaca cacacacaga ccacacatat acaccacata
10021 ctgcatacat gtatacacac tatatacaca tataaacata ttacaaaata cacacaacca
10081 cacatataca tcatacatac atacacatat atacatatca catatacaaa catataatag
10141 gccacacata tgcaacacac atgtacaccc caaacacata tacatagcat acaccccaca
10201 aacacaccat atacatatac aacacataca tcatatccta tccacaccac acacacatat
10261 gaaccataca ttcacatatc atgcacatac acacacatat acacacacat acacaaccac
10321 atacacccca cataatattc aacatattca ccataatact acctcacgct acaaacacat
10381 acacatatga catacataca cacaaaccaa tataatatat gaaatggttc tctgatattg
10441 acccaatata tttgaacatg gaagtttgaa gacgtatttg taatcttttt tctttttttt
10501 tttctataga ctgccagtac atatgaattt ttctatgtgt actgatttgt gtttgattta
10561 ttgttttcca ggtgtacacc tctgaagaaa gatgatgtgt cagaaattct atgtggtttt
10621 gttacactgg ggtaagtggc acacaccttt gagttttggg gatgatatta ctatagagtg
10681 tgtttctaaa gaggaacttt atgttgactg atacctggta ctttgtggtc cca
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsHua Huang, Bruce Beutler
Edit History
2011-07-06 3:10 PM (current)
2011-01-31 9:14 AM
2010-12-08 3:38 PM
2010-08-26 2:09 PM
2010-08-26 2:09 PM
2010-08-26 2:08 PM
2010-04-22 9:42 AM
2010-02-03 4:30 PM