Phenotypic Mutation 'mayday_circler'

• Allele: mayday_circler
• Mutation Type: nonsense
• Chromosome: 9
• Coordinate: 80,153,733 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Myo6
• Gene Name: myosin VI
• Synonym(s): Myo6, Tlc, rsv
• Chromosomal Location: 80,072,313-80,219,011 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014] ; PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000036181; Gene: ENSMUSG00000033577; AA Change: C236*

Domain	Start	End	E-Value	Type
MYSc	51	772	N/A	SMART
IQ	812	834	8.58e-1	SMART
low complexity region	909	980	N/A	INTRINSIC
low complexity region	982	1002	N/A	INTRINSIC
Blast:MYSc	1003	1113	3e-29	BLAST
PDB:3H8D|D	1134	1262	1e-74	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000075501; Gene: ENSMUSG00000033577; AA Change: C236*

Domain	Start	End	E-Value	Type
MYSc	51	772	N/A	SMART
IQ	812	834	8.58e-1	SMART
low complexity region	909	980	N/A	INTRINSIC
low complexity region	982	1002	N/A	INTRINSIC
Blast:MYSc	1003	1126	2e-27	BLAST
PDB:3H8D|D	1138	1266	8e-75	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000108891; Gene: ENSMUSG00000033577; AA Change: C236*

Domain	Start	End	E-Value	Type
MYSc	51	772	N/A	SMART
IQ	812	834	8.58e-1	SMART
low complexity region	909	980	N/A	INTRINSIC
low complexity region	982	1002	N/A	INTRINSIC
Blast:MYSc	1003	1113	3e-29	BLAST
PDB:3H8D|D	1125	1253	9e-75	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000108893; Gene: ENSMUSG00000033577; AA Change: C236*

Domain	Start	End	E-Value	Type
MYSc	51	772	N/A	SMART
IQ	812	834	8.58e-1	SMART
low complexity region	909	980	N/A	INTRINSIC
low complexity region	982	1002	N/A	INTRINSIC
Blast:MYSc	1003	1135	2e-26	BLAST
Pfam:Myosin-VI_CBD	1167	1257	1.4e-46	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139228; Gene: ENSMUSG00000033577; AA Change: C236*

Domain	Start	End	E-Value	Type
MYSc	51	772	N/A	SMART
IQ	812	834	8.58e-1	SMART
low complexity region	909	980	N/A	INTRINSIC
low complexity region	982	1002	N/A	INTRINSIC
Blast:MYSc	1003	1136	1e-26	BLAST
PDB:3H8D|D	1157	1285	9e-75	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139019; Gene: ENSMUSG00000033577; AA Change: C236*

Domain	Start	End	E-Value	Type
MYSc	51	772	N/A	SMART
IQ	812	834	8.58e-1	SMART
low complexity region	909	980	N/A	INTRINSIC
low complexity region	982	1002	N/A	INTRINSIC
Blast:MYSc	1003	1145	1e-25	BLAST
PDB:3H8D|D	1166	1294	8e-75	PDB

• Predicted Effect: probably null
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2018-05-22 9:35 AM by Anne Murray
• Record Created: 2009-09-30 12:00 AM
• Record Posted: 2010-06-23
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Sungyong Won, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001039546; MGI: 104785

Alleles Listed at MGI

All alleles(13) : Targeted, other(2) Gene trapped(6) Spontaneous(3) Chemically induced(2)

Repository

none

Phenotypic Description

The mayday circler phenotype was identified in a group of ENU-mutagenized mice to be tested for suppression of the mayday phenotype. Mayday circler mice exhibit bidirectional circling and head tilting ('stargazing'), phenotypes that are much more apparent when the mice are alone. 

Nature of Mutation

The mayday circler mutation was mapped by bulk segregation analysis (BSA) of F2 backcross offspring using C57BL/10J as the mapping strain (n=13 mice mutant phenotype, 13 with normal phenotype) . The mutation showed strongest linkage with marker B10SNPS0144 at position 87513872 bp on Chromosome 9 (synthetic LOD=7.8, P=2.48x10^-4). Myo6, located 7.5 Mb from B10SNPS0144, was identified as a candidate gene that when mutated causes circling, head tossing, and hyperactive behavior, and was directly sequenced. A T to A transversion at position 929 of the Myo6 transcript, in exon 9 of 33 total exons, was found in mayday circler mice.

912 GAGAAGTCTAGGATCTGTGTTCAAGGCAAAGAG
231 -E--K--S--R--I--C--V--Q--G--K--E-

The mutated nucleotide (red) converts codon 236, normally encoding cysteine, to a premature stop codon.

Protein Prediction

Myosins are actin-based molecular motors for various cellular cargoes, producing mechanical force through repeated cycles of ATP hydrolysis. They are composed of one or two heavy chains and one to six non-covalently associated light chains. All myosins contain a catalytic head or motor domain containing ATP- and actin-binding sites. Within the motor domain is a converter domain that undergoes an ~70° rotation powered by ATP hydrolysis in the myosin head. Connected to the converter are one or more calmodulin light chain-binding domains (also called IQ domains) that form an extension from the myosin catalytic domain known as the lever arm or neck. This lever arm amplifies the movements of the converter domain, which transitions between pre-stroke and post-stroke states, providing the power for movement along an actin filament.  Myosins are classified into some 30 classes based on differences in the sequences of their motor domains (1); each class also has a characteristic and distinct tail domain (2). Myosins are also divided into conventional (muscle myosins and myosins similar in structure and function to muscle myosins, all belonging to class II) and unconventional classes (myosins that do not resemble muscle myosins). Myosin VI is a 1262-amino acid unconventional myosin heavy chain (MHC).

 

Figure 1. Myosin ATP hydrolysis cycle and movement along actin. Unbound myosin is attached to actin in a rigor state. (A) ATP binds to a cleft in the myosin head causing a slight conformational change in the actin-binding site and consequent release of the actin filament. (B) Upon ATP hydrolysis, the myosin head with ADP and P_i still bound, moves into the "cocked" pre-stroke state and binds relatively weakly to a new site on the actin filament. (C) This binding causes P_i to be released, resulting in a transition from a weak to a strong actin-binding state that triggers the powerstroke (D), during which ADP is released and myosin returns to its original conformation attached to actin in a rigor state. Click on the image to view an animation of the myosin movement cycle.

We now have a relatively detailed understanding of how the conformation of myosin motors is coupled to ATP hydrolysis to drive movement along actin (Figure 1), an idea first proposed in 1969 by H.E. Huxley in the swinging crossbridge hypothesis [(3), reviewed in (4)]. The cycle begins when hydrolysis of a bound ATP molecule causes the motor to move into the pre-stroke state and associate with an actin subunit. Release of inorganic phosphate (P_i) triggers the motor to pivot into the post-stroke state, thus effecting the power stroke. At the same time, the motor transitions from a weak to a strong actin-binding state. The myosin remains tightly bound to actin until ADP is released, when another ATP molecule rapidly binds and causes myosin to dissociate from the actin filament to complete the cycle. In each successive cycle, myosin binds to a new actin subunit further down along the filament, thus resulting in the relative movement of myosin along the actin filament. For myosins that function as dimers, coordination of movement between the two head domains, termed ‘gating’, is necessary for these myosins to move processively along or to anchor to actin filaments. Gating in myosin VI is achieved by blocking ATP binding to the lead head until the rear head detaches from actin, thus holding one head of the dimer attached to actin at all times (5). The positioning of a structure in the head domain, termed insert-1, over the ATP binding pocket prevents ATP but not ADP binding to the lead head until release of the rear head.

 

Figure 2. Domain structure of myosin VI. At its N-terminus, myosin VI has an ATP- and actin-binding catalytic head with converter domain. Two inserted sequences close to the nucleotide-binding pocket and between the converter domain and canonical IQ domain serve, respectively, to slow the rate of ATP binding to the lead head in a dimer and to reverse the directionality of myosin VI movement along the actin filament relative to other myosins. Both insert-2 and the canonical IQ domain bind to calmodulin light chains. The C-terminal tail consists of a cargo-binding domain, and proximal (PT) and medial tail (MT) domains, one of which may provide a lever arm extension that accounts for the large step size of myosin VI. Alternative splicing of the tail domain results in the possible inclusion of one or two inserted sequences; the sequences may affect the function of myosin VI in endocytosis.The mayday circler mutation (red asterisk) changes a cysteine to a premature stop codon at amino acid 236. 

Like other myosins, myosin VI has at its N-terminus a catalytic head with converter domain followed by a single canonical light chain-binding domain (FIgure 2) (6;7). The catalytic head is similar to that of myosin II and myosin V (see new gray), except that myosin VI additionally contains two inserted sequences. Insert-1 is 26 amino acids in length and located close to the nucleotide-binding pocket; it serves to slow the rate of ATP binding to the lead head in a myosin VI dimer (8). Insert-2, also known as the ‘unique insert’, is a sequence of 53 amino acids between the converter domain and the canonical calmodulin-binding domain (8;9) that itself can bind to a single calmodulin (10) and serves to reverse the directionality of myosin VI movement relative to other myosins (see below). The C-terminal tail domains of unconventional myosins vary in sequence and function. In myosin VI, the tail consists of a proximal tail domain (also called the lever arm extension, LAE), a medial tail domain (also called the single α-helix domain, SAH), and a globular cargo-binding domain. In mammalian cells, alternative splicing of the tail domain gives rise to four distinct myosin VI isoforms that may localize and function differentially in cells (see Background) (11). The four isoforms contain either a large insert (21-31 amino acids) at the C-terminal end of the medial tail domain, a small insert (9 amino acids) within the cargo-binding domain, both inserts, or no insert.

 

Myosin VI dimers can move processively with a relatively large 30-36 nm step size along actin filaments (12;13), compared to ~10 nm for myosin II (14). This is in part due to the large arc of rotation through which myosin VI swings its lever arm with each power stroke (15;16). A rearrangement of the helices of the converter during the transition from pre-stroke to post-stroke states permits myosin VI to swing its lever arm through an arc of ~180° (17), much larger than the ~70° stroke characteristic of other myosins. However, even with the large lever arm rotation, the stroke size of a single myosin VI molecule truncated after the calmodulin-binding domain is only 12 nm (18), whereas that of a myosin VI dimer is 36 nm, suggesting that a lever arm extension is necessary to account for the full step size of myosin VI.

 

Long lever arms, typically resulting from the presence of many calmodulin-binding sites, result in a large step size, as for example in myosin V that has six calmodulin-binding sites and a step size of approximately 36 nm. However, the myosin VI lever arm contains only the insert-2 calmodulin-binding site and a second conventional calmodulin-binding site. Debate currently exists as to whether it is the proximal tail or medial tail that provides the lever arm extension that accounts for the large myosin VI step size. In support of the hypothesis that the medial tail domain acts to extend the lever arm of myosin VI, several reports provided evidence that the medial tail forms a rare, extended 10-nm single α-helix (rather than a coiled-coil as originally predicted (9)) that is sufficiently rigid to function as a mechanical extension (19;20). On the other hand, another group demonstrated that the proximal tail folds into a three-helix bundle that unfolds when myosin VI dimerizes (21). Dimerization could occur in a region located between the proximal and medial tails, and deletion of most of the medial tail did not impact the average step size or step size distribution, strongly suggesting that it is not the medial tail, but the flexible proximal tail that serves as the lever arm extension. Further studies are necessary to establish the structural basis of the large step size of myosin VI.

 

Myosin VI moves along actin toward the minus (pointed) end, in the opposite direction to all other myosins that have been characterized, which move towards the plus (barbed) end (22). This ability is imparted by structural adaptations that reposition the myosin VI lever arm to point in the opposite direction to that of other myosins. The unique insert is sufficient for lever arm repositioning in myosin VI (23;24). It interacts with the converter and thereby redirects the lever arm in the opposite direction (8).

 

Figure 3. Myosin VI motor domain in the post-stroke state. The myosin VI converter rotates 180° during the powerstroke. The location of the mayday circler mutation is indicated in red. UCSF Chimera structure is based on PDB 2VAS. Click on the image to view the structure rotate.

Whether myosin VI functions as a monomer, dimer, or both is not definitively known. Many myosins contain a coiled coil in their tail domains by which they homodimerize, and when the primary sequence of myosin VI was first analyzed, its tail region was also predicted to contain a coiled coil (proximal and medial tail regions) and presumed to dimerize (9). Consequently, most studies of myosin VI have used a construct truncated near the end of the predicted coiled coil and forced to dimerize by the addition of a strong coiled coil such as the leucine zipper of GCN4 (6;7). Surprisingly, full length myosin VI isolated from cells was found to be monomeric (25), and appears to form a folded structure (19). So far, it appears that clustering of myosin VI monomers at their C-terminal ends triggers dimerization (26;27), and motor activity is hypothesized to be regulated by cargo-induced dimerization. It may be that myosin VI diffuses more efficiently through the actin network at the cell periphery as a folded monomer (19;21;26).

 

The mayday circler mutation is located in the catalytic head domain, approximately 100 amino acids C-terminal to the ATP binding site (Figure 3).

Expression/Localization

By immunoblotting, myosin VI has been detected in all tissues examined: kidney cortex, intestinal mucosa, liver, lung, heart, jowl muscle, and brain (cortex and medulla) (9). It is most highly expressed in the kidney, where it is localized at the base of microvilli of proximal tubule cells (28). Myosin VI is localized at the apical brush border of intestinal enterocytes (29;30) and at the apical membrane of polarized human airway epithelial cells (Calu-3) (31).  In the brain, myosin VI is localized to synapses and enriched at the postsynaptic density (32). In fibroblasts, myosin VI is found on the Golgi and at the leading edge after growth factor stimulation (33).

 

Myosin VI is expressed in the inner and outer hair cells of the sensory epithelium in the adult mouse cochlea (34;35). It was found concentrated within the actin-dense cuticular plate at the base of the stereocilia and in the pericuticular necklace around the cuticular plate, and it is present within stereocilia themselves (36). Myosin VI is detectable in presumptive hair cells by day 13.5 of gestation (37).

Background

Myosin VI was first discovered in Drosophila melanogaster as a 140-kD actin-binding protein that is released from actin in the presence of ATP (38;39). Drosophila myosin VI, designated 95F myosin heavy chain, is encoded by at least three alternatively spliced transcripts and is expressed throughout fly development. 95F is required for the transport of cytoplasmic particles (40) during organization of the embryonic syncytial blastoderm (41), and during oogenesis (42). It also functions in asymmetric protein localization in Drosophila neuroblasts (43), and in stabilization of the armadillo (Drosophila β-catenin)-cadherin complex in the ovary (44), which are required for proper mitotic spindle orientation and cell migration, respectively. In addition, 95F is essential for spermatogenesis, and mutations in 95F result in male sterility due to a failure in spermatid individualization (45). In 95F mutants, stabilization of the branched actin network between distinct spermatids (46), and localization of the actin polymerization regulatory proteins cortactin and the Arp2/3 complex are impaired (47).

 

Figure 4. Cellular functions of myosin VI. Myosin VI is required for clathrin-mediated endocytosis (A), for anchoring the plasma membrane between filopodia to the actin cytoskeleton (B), and for maintaining Golgi structure via a complex containing optineurin and Rab8 (C).

Mammalian myosin VI was identified in a pig kidney proximal tubule cell line, where it localizes to the actin- and membrane-rich apical brush border of these polarized epithelial cells (9). One year later in 1995, a mutation in mouse myosin VI was implicated through positional cloning as the cause of Snell’s waltzer (sv) phenotype (35), which arose spontaneously in 1960 and is characterized by circling behavior, head tossing, deafness, and hyperactivity observable by 12 days of age (48). The sv mutation is a 1.1 kilobase intragenic deletion within the Myo6 locus that results in a 130 bp deletion from the Myo6 mRNA. The deletion results in a frameshift that introduces a stop codon into the lever arm region of the protein. Although the appearance of hair cells and their stereocilia is relatively normal at birth in homozygous Myo6^sv/sv mice, the stereocilia undergo progressive disorganization and a raising of the hair cell apical plasma membrane between stereocilia such that by three days of age all hair cells show fused stereocilia and by 20 days giant stereocilia are observed on top of hair cells (49). The formation of stereocilial branches is also observed at one day of age (50). By 6 weeks, there is a complete degeneration of both inner and outer hair cells within the Organ of Corti (35). A very similar phenotype was observed in zebrafish with a mutation of Myo6b, the myosin VI isoform expressed in the sensory epithelium of the ear and lateral line (51). Based on these phenotypes and the observed localization of myosin VI to the cuticular plate at the base of stereocilia, it has been hypothesized that myosin VI plays a structural role in anchoring the plasma membrane between individual stereocilia to the actin filaments that form their core (Figure 4B) (36;49;51). In the absence of myosin VI, the unanchored membrane may rise up between stereocilia, resulting in fusion beginning at the base and continuing up to the tips of stereocilia.

 

Mutations in MYO6 are associated with hearing loss in humans. In contrast to the recessive inheritance pattern of Myo6 phenotypes in mice, in humans MYO6 mutations have been linked with both dominant (OMIM #606346) (52) and recessive non-syndromic hearing loss (OMIM #607821) (53), as well as with dominant syndromic hearing loss that includes hypertrophic cardiomyopathy (54). A dominantly inherited atrial septal defect has also been shown to be caused by a missense mutation in myosin VI (55). Overexpression of myosin VI has been observed in human prostate cancer specimens (56), and contributes to enhanced prostate-specific antigen (PSA) and vascular endothelial growth factor (VEGF) secretion by a prostate cancer cell line (LNCaP) (57).

 

Myosin VI is involved in membrane trafficking, both exocytosis and endocytosis [reviewed in (58)]. Myosin VI is present in vesicles at the Golgi complex, and fibroblasts derived from Myo6^sv/sv mice display a 40% reduction in the size of the Golgi network as well as a 40% reduction in protein secretion from the trans Golgi network to the plasma membrane (33;59). These defects are rescued by expression of full length myosin VI. In polarized MDCK cells, the myosin VI isoform lacking the tail domain insert is required for sorting and transport to the basolateral membrane of newly synthesized proteins containing a tyrosine-based sorting motif via the AP-1B complex (60). Myosin VI is recruited to the Golgi complex by optineurin (61) and the small G-protein Rab8; these proteins may form a transport complex for proteins destined for the basolateral membrane in polarized epithelial cells (Figure 4C)(60). However, since actin is generally oriented with minus ends pointing into the cell, it remains unclear how a minus end-directed motor would mediate this type of transport.

 

Minus end-directed transport by myosin VI is consistent with a role in endocytosis, and strong evidence supports a role for myosin VI in this process (Figure 4A). Myo6^sv/sv fibroblasts exhibit abnormally shallow clathrin-coated pits and reduced internalization of clathrin-coated vesicles (62). Myosin VI can be detected at the base of the brush border in kidney proximal tubule cells, closely associated with AP-2 at the intermicrovillar coated pit region (28), where it is required for endocytosis-mediated protein absorption by the kidney (63). Similarly, myosin VI is localized at the apical brush border of intestinal enterocytes (29;30) and at the apical membrane of polarized human airway epithelial cells (Calu-3) (31), where it is necessary for endocytosis of cystic fibrosis transmembrane conductance regulator (CFTR). Finally, myosin VI exists in a complex with AP-2, SAP97, and AMPA receptors in the brain, and is required for stimulation-induced internalization of AMPA receptors in hippocampal neurons likely by clathrin-mediated endocytosis (32;64). Myosin VI deficiency results in reductions in synapse number, changes in synapse structure, and astrogliosis (32;65).

 

The function of myosin VI in endocytosis may depend on the cell type in which it is functioning and/or on the isoform of myosin VI present. One report suggested that the myosin VI isoform containing the large insert is preferentially expressed in polarized epithelial cells with microvilli, while the isoform containing the small or no insert is predominantly expressed in cells lacking microvilli (11). Large-insert myosin VI colocalized with clathrin-coated pits via its cargo-binding domain in a polarized colorectal adenocarcinoma cell line (Caco-2) and in nonpolarized rat kidney cells, and could be immunoprecipitated in a complex containing AP-2 and clathrin (11). Overexpression of the tail domain containing the large insert reduced endocytosis by 50%, as measured by transferrin receptor uptake, whereas overexpression of the tail domain lacking the insert had no effect on endocytosis. The presence of the large tail domain insert also enhanced myosin VI localization to clathrin-coated pits. These findings suggested that myosin VI containing the large insert may function at an early stage of endocytosis, such as during invagination, pinching off, or early transport prior to uncoating.

 

In contrast, in a retinal pigmented epithelial cell line (ARPE-19), myosin VI lacking the tail domain insert was not present on clathrin-coated pits but instead was transiently recruited to transferrin-containing newly uncoated endocytic vesicles before fusion with early endosomes (66).  Overexpression of the myosin VI tail domain with no insert reduced the rate of transferrin receptor uptake. Rescue of the defect in clathrin-mediated endocytosis in Myo6^sv/sv fibroblasts by re-expression of the no-insert isoform demonstrated that this isoform can perform all myosin VI functions necessary for endocytosis (62). Further work suggested that myosin VI moves endocytic vesicles through the actin-rich region at the cell periphery for fusion with the early endosome (67). Thus, myosin VI is essential for normal endocytosis, but it remains unclear whether large-insert and no-insert isoforms of myosin VI possess distinct functions, or whether its role in endocytosis is cell type-specific.

 

Multiple regulatory mechanisms modulate the activity of myosin VI: 1) The expression of alternatively spliced isoforms that may carry out distinct cellular functions, as described above. 2) Myosin VI is phosphorylated at multiple sites (33), which may regulate the binding of interactors such as optineurin (61). 3) Calcium binding to the calmodulin light chain may affect the kinetic properties of myosin VI. Increases in calcium concentration have been shown to reduce the rate of ADP release and movement along actin filaments in an artificial myosin VI dimer (68). 4) Myosin VI binds strongly to the phosphoinositide PI(4,5)P₂, an interaction that promotes dimerization and localization to clathrin-coated pits (72). 5) The binding of adapters and interactors has been shown to result in myosin VI dimerization from the folded monomeric state, thus activating processive motor activity along actin filaments. It has been postulated that monomeric myosin VI can more effectively diffuse through actin networks to the cell periphery where it appears to act.

 

Binding partners enable myosin VI to carry out its specific cellular functions.  As mentioned above, optineurin and Rab8 link myosin VI to the Golgi complex (61) to facilitate exocytosis and to maintain Golgi structure.  Disabled-2 (Dab2) is another myosin VI binding partner present on endocytic clathrin-coated structures at the plasma membrane (69). Dab2 plays a key role in clathrin-mediated endocytosis of members of the low density lipoprotein receptor (LDLR) family by interacting with PIP₂, AP-2, and clathrin (70;71). Myosin VI is recruited to clathrin coated pits by binding to Dab2 and PIP₂ (72). A complex containing Dab2, AP-2, and myosin VI mediates endocytosis of CFTR channels in the intestine (73). GIPC and SAP97 are also myosin VI adapters that may ­­mediate endocytosis of transmembrane receptors such as the LDL receptor megalin, human lutropin receptor, and the β-1 adrenergic receptor (74), and AMPA receptors (32), respectively. GIPC also couples myosin VI to uncoated endocytic vesicles (74). TRAF6-binding protein (T6BP) was identified as a myosin VI binding protein by yeast two-hybrid assay; since T6BP was found to inhibit NF-κB activation, myosin VI-T6BP interactions may link membrane trafficking and cytoskeletal organization with cytokine-dependent signaling (75). Myosin VI and vinculin were recently shown to interact during the formation of cadherin-based adhesive contacts between cultured epithelial cells (76). Finally, although previously presumed to localized solely to the cytoplasm, myosin VI has been identified in the nucleus of mammalian cells, where it modulates the RNA polymerase II-dependent transcription of active genes (77).

Putative Mechanism

The phenotype of mayday circler mice is consistent with a functionally null mutation. The mayday circler mutation converts codon 236, normally encoding cysteine, to a premature stop codon that may trigger nonsense mediated decay of the transcript, resulting in complete absence of the protein in the mouse. It has been hypothesized that the hair cells of the cochlea are particularly sensitive to myosin VI deficiency because they lack compensatory mechanisms for coping with loss of myosin VI function.  Thus, Myo6 mutants display inner ear defects, but otherwise develop and reproduce relatively normally. In support of this hypothesis, it has been observed in fibroblasts that caveolae-dependent endocytosis can partially compensate for impaired clathrin-mediated endocytosis resulting from deficiency of myosin VI (62).

Primers

Primers cannot be located by automatic search.

Genotyping

Mayday circler genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers

mayday circler (F): 5’-ACAGCAGATTTTCATGGTGGTGAGC -3’

mayday circler (R): 5’- CCTGAGATCCTGGTGTGACAAAGC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

mayday circler_seq(F): 5’- TGCACTGCTAAGTCAGTTCTG -3’

mayday circler_seq(R): 5’- AGTTTGCACCCAAGGTCTG -3’

 

The following sequence of 916 nucleotides (from Genbank genomic region NC_­­­­­000075 for linear genomic sequence of Myo6, sense strand) is amplified:

 

                                                                acagcag

81061 attttcatgg tggtgagctg agagctcttt agcaacagtc tatgggctgc tgtggacact

81121 ggtgtgcact gctaagtcag ttctgattct ggagaggctc agggtagaga ttggataaca

81181 atgtttaaaa tgaaggagaa ataatcaaag cttacattgt aggtgtcttt gtctagtatt

81241 taataaacat tttaacttct ttgacaagca aatgtttatt agaaaaagtt agtttagcat

81301 tgagttatat ttcaatccca cggatataaa atgtattttc tattttgtct tttagagttc

81361 ggttgttgga ggatttgttt cccattacct tctagagaag tctaggatct gtgttcaagg

81421 caaagaggag cggaattacc atattttcta caggctctgt gctggggctt cagaagacat

81481 cagggagaag cttcacttga gctccccaga taatttccgg gtaggttgga ggaaaataaa

81541 ttttatacca ggtttgcaaa tcgttcttcg tcctaaaact tactggtttt ggagtcctac

81601 ttgtttttgt acataactta tgttaaatca agcacagtgg gctttctggg cttgcagagt

81661 ttcatctcaa gattaactat gaattgcaaa taatgggaat gataaagaga gcacctctgg

81721 aggaggacac aacatctgcc ccaacaccag aattaactgg gaccagcggg acctaggaac

81781 tctgtctgac ccgtggcatg ggttccttcc cgtctgagcc agtgccctga gcagaccttg

81841 ggtgcaaact ccacagccag tcccacaaca cccagaggaa gctcttctcc caggcactct

81901 aacactccca ggtccacagg atcccaggat cccaggatcc caagagcttt gtcacaccag

81961 gatctcagg

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

1. Richards, T. A., and Cavalier-Smith, T. (2005) Myosin Domain Evolution and the Primary Divergence of Eukaryotes. Nature. 436, 1113-1118.

2. Korn, E. D. (2000) Coevolution of Head, Neck, and Tail Domains of Myosin Heavy Chains. Proc. Natl. Acad. Sci. U. S. A. 97, 12559-12564.

3. Huxley, H. E. (1969) The Mechanism of Muscular Contraction. Science. 164, 1356-1365.

4. Geeves, M. A., and Holmes, K. C. (1999) Structural Mechanism of Muscle Contraction. Annu. Rev. Biochem. 68, 687-728.

5. Sweeney, H. L., Park, H., Zong, A. B., Yang, Z., Selvin, P. R., and Rosenfeld, S. S. (2007) How Myosin VI Coordinates its Heads during Processive Movement. EMBO J. 26, 2682-2692.

6. Sweeney, H. L., and Houdusse, A. (2010) Myosin VI Rewrites the Rules for Myosin Motors. Cell. 141, 573-582.

7. Spudich, J. A., and Sivaramakrishnan, S. (2010) Myosin VI: An Innovative Motor that Challenged the Swinging Lever Arm Hypothesis. Nat. Rev. Mol. Cell Biol. 11, 128-137.

8. Menetrey, J., Bahloul, A., Wells, A. L., Yengo, C. M., Morris, C. A., Sweeney, H. L., and Houdusse, A. (2005) The Structure of the Myosin VI Motor Reveals the Mechanism of Directionality Reversal. Nature. 435, 779-785.

9. Hasson, T., and Mooseker, M. S. (1994) Porcine Myosin-VI: Characterization of a New Mammalian Unconventional Myosin. J. Cell Biol. 127, 425-440.

10. Bahloul, A., Chevreux, G., Wells, A. L., Martin, D., Nolt, J., Yang, Z., Chen, L. Q., Potier, N., Van Dorsselaer, A., Rosenfeld, S., Houdusse, A., and Sweeney, H. L. (2004) The Unique Insert in Myosin VI is a Structural Calcium-Calmodulin Binding Site. Proc. Natl. Acad. Sci. U. S. A. 101, 4787-4792.

11. Buss, F., Arden, S. D., Lindsay, M., Luzio, J. P., and Kendrick-Jones, J. (2001) Myosin VI Isoform Localized to Clathrin-Coated Vesicles with a Role in Clathrin-Mediated Endocytosis. EMBO J. 20, 3676-3684.

12. Nishikawa, S., Homma, K., Komori, Y., Iwaki, M., Wazawa, T., Hikikoshi Iwane, A., Saito, J., Ikebe, R., Katayama, E., Yanagida, T., and Ikebe, M. (2002) Class VI Myosin Moves Processively Along Actin Filaments Backward with Large Steps. Biochem. Biophys. Res. Commun. 290, 311-317.

13. Rock, R. S., Rice, S. E., Wells, A. L., Purcell, T. J., Spudich, J. A., and Sweeney, H. L. (2001) Myosin VI is a Processive Motor with a Large Step Size. Proc. Natl. Acad. Sci. U. S. A. 98, 13655-13659.

14. Finer, J. T., Simmons, R. M., and Spudich, J. A. (1994) Single Myosin Molecule Mechanics: Piconewton Forces and Nanometre Steps. Nature. 368, 113-119.

15. Reifenberger, J. G., Toprak, E., Kim, H., Safer, D., Sweeney, H. L., and Selvin, P. R. (2009) Myosin VI Undergoes a 180 Degrees Power Stroke Implying an Uncoupling of the Front Lever Arm. Proc. Natl. Acad. Sci. U. S. A. 106, 18255-18260.

16. Sun, Y., Schroeder, H. W.,3rd, Beausang, J. F., Homma, K., Ikebe, M., and Goldman, Y. E. (2007) Myosin VI Walks "Wiggly" on Actin with Large and Variable Tilting. Mol. Cell. 28, 954-964.

17. Menetrey, J., Llinas, P., Mukherjea, M., Sweeney, H. L., and Houdusse, A. (2007) The Structural Basis for the Large Powerstroke of Myosin VI. Cell. 131, 300-308.

18. Rock, R. S., Ramamurthy, B., Dunn, A. R., Beccafico, S., Rami, B. R., Morris, C., Spink, B. J., Franzini-Armstrong, C., Spudich, J. A., and Sweeney, H. L. (2005) A Flexible Domain is Essential for the Large Step Size and Processivity of Myosin VI. Mol. Cell. 17, 603-609.

19. Spink, B. J., Sivaramakrishnan, S., Lipfert, J., Doniach, S., and Spudich, J. A. (2008) Long Single Alpha-Helical Tail Domains Bridge the Gap between Structure and Function of Myosin VI. Nat. Struct. Mol. Biol. 15, 591-597.

20. Sivaramakrishnan, S., Spink, B. J., Sim, A. Y., Doniach, S., and Spudich, J. A. (2008) Dynamic Charge Interactions Create Surprising Rigidity in the ER/K Alpha-Helical Protein Motif. Proc. Natl. Acad. Sci. U. S. A. 105, 13356-13361.

21. Mukherjea, M., Llinas, P., Kim, H., Travaglia, M., Safer, D., Menetrey, J., Franzini-Armstrong, C., Selvin, P. R., Houdusse, A., and Sweeney, H. L. (2009) Myosin VI Dimerization Triggers an Unfolding of a Three-Helix Bundle in Order to Extend its Reach. Mol. Cell. 35, 305-315.

22. Wells, A. L., Lin, A. W., Chen, L. Q., Safer, D., Cain, S. M., Hasson, T., Carragher, B. O., Milligan, R. A., and Sweeney, H. L. (1999) Myosin VI is an Actin-Based Motor that Moves Backwards. Nature. 401, 505-508.

23. Park, H., Li, A., Chen, L. Q., Houdusse, A., Selvin, P. R., and Sweeney, H. L. (2007) The Unique Insert at the End of the Myosin VI Motor is the Sole Determinant of Directionality. Proc. Natl. Acad. Sci. U. S. A. 104, 778-783.

24. Bryant, Z., Altman, D., and Spudich, J. A. (2007) The Power Stroke of Myosin VI and the Basis of Reverse Directionality. Proc. Natl. Acad. Sci. U. S. A. 104, 772-777.

25. Lister, I., Schmitz, S., Walker, M., Trinick, J., Buss, F., Veigel, C., and Kendrick-Jones, J. (2004) A Monomeric Myosin VI with a Large Working Stroke. EMBO J. 23, 1729-1738.

26. Phichith, D., Travaglia, M., Yang, Z., Liu, X., Zong, A. B., Safer, D., and Sweeney, H. L. (2009) Cargo Binding Induces Dimerization of Myosin VI. Proc. Natl. Acad. Sci. U. S. A. 106, 17320-17324.

27. Park, H., Ramamurthy, B., Travaglia, M., Safer, D., Chen, L. Q., Franzini-Armstrong, C., Selvin, P. R., and Sweeney, H. L. (2006) Full-Length Myosin VI Dimerizes and Moves Processively Along Actin Filaments upon Monomer Clustering. Mol. Cell. 21, 331-336.

28. Biemesderfer, D., Mentone, S. A., Mooseker, M., and Hasson, T. (2002) Expression of Myosin VI within the Early Endocytic Pathway in Adult and Developing Proximal Tubules. Am. J. Physiol. Renal Physiol. 282, F785-94.

29. Ameen, N., and Apodaca, G. (2007) Defective CFTR Apical Endocytosis and Enterocyte Brush Border in Myosin VI-Deficient Mice. Traffic. 8, 998-1006.

30. Heintzelman, M. B., Hasson, T., and Mooseker, M. S. (1994) Multiple Unconventional Myosin Domains of the Intestinal Brush Border Cytoskeleton. J. Cell. Sci. 107 ( Pt 12), 3535-3543.

31. Swiatecka-Urban, A., Boyd, C., Coutermarsh, B., Karlson, K. H., Barnaby, R., Aschenbrenner, L., Langford, G. M., Hasson, T., and Stanton, B. A. (2004) Myosin VI Regulates Endocytosis of the Cystic Fibrosis Transmembrane Conductance Regulator. J. Biol. Chem. 279, 38025-38031.

32. Osterweil, E., Wells, D. G., and Mooseker, M. S. (2005) A Role for Myosin VI in Postsynaptic Structure and Glutamate Receptor Endocytosis. J. Cell Biol. 168, 329-338.

33. Buss, F., Kendrick-Jones, J., Lionne, C., Knight, A. E., Cote, G. P., and Paul Luzio, J. (1998) The Localization of Myosin VI at the Golgi Complex and Leading Edge of Fibroblasts and its Phosphorylation and Recruitment into Membrane Ruffles of A431 Cells After Growth Factor Stimulation. J. Cell Biol. 143, 1535-1545.

34. Avraham, K. B., Hasson, T., Sobe, T., Balsara, B., Testa, J. R., Skvorak, A. B., Morton, C. C., Copeland, N. G., and Jenkins, N. A. (1997) Characterization of Unconventional MYO6, the Human Homologue of the Gene Responsible for Deafness in Snell's Waltzer Mice. Hum. Mol. Genet. 6, 1225-1231.

35. Avraham, K. B., Hasson, T., Steel, K. P., Kingsley, D. M., Russell, L. B., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1995) The Mouse Snell's Waltzer Deafness Gene Encodes an Unconventional Myosin Required for Structural Integrity of Inner Ear Hair Cells. Nat. Genet. 11, 369-375.

36. Hasson, T., Gillespie, P. G., Garcia, J. A., MacDonald, R. B., Zhao, Y., Yee, A. G., Mooseker, M. S., and Corey, D. P. (1997) Unconventional Myosins in Inner-Ear Sensory Epithelia. J. Cell Biol. 137, 1287-1307.

37. Xiang, M., Gao, W. Q., Hasson, T., and Shin, J. J. (1998) Requirement for Brn-3c in Maturation and Survival, but Not in Fate Determination of Inner Ear Hair Cells. Development. 125, 3935-3946.

38. Kellerman, K. A., and Miller, K. G. (1992) An Unconventional Myosin Heavy Chain Gene from Drosophila Melanogaster. J. Cell Biol. 119, 823-834.

39. Miller, K. G., Field, C. M., and Alberts, B. M. (1989) Actin-Binding Proteins from Drosophila Embryos: A Complex Network of Interacting Proteins Detected by F-Actin Affinity Chromatography. J. Cell Biol. 109, 2963-2975.

40. Mermall, V., McNally, J. G., and Miller, K. G. (1994) Transport of Cytoplasmic Particles Catalysed by an Unconventional Myosin in Living Drosophila Embryos. Nature. 369, 560-562.

41. Mermall, V., and Miller, K. G. (1995) The 95F Unconventional Myosin is Required for Proper Organization of the Drosophila Syncytial Blastoderm. J. Cell Biol. 129, 1575-1588.

42. Bohrmann, J. (1997) Drosophila Unconventional Myosin VI is Involved in Intra- and Intercellular Transport during Oogenesis. Cell Mol. Life Sci. 53, 652-662.

43. Petritsch, C., Tavosanis, G., Turck, C. W., Jan, L. Y., and Jan, Y. N. (2003) The Drosophila Myosin VI Jaguar is Required for Basal Protein Targeting and Correct Spindle Orientation in Mitotic Neuroblasts. Dev. Cell. 4, 273-281.

44. Geisbrecht, E. R., and Montell, D. J. (2002) Myosin VI is Required for E-Cadherin-Mediated Border Cell Migration. Nat. Cell Biol. 4, 616-620.

45. Hicks, J. L., Deng, W. M., Rogat, A. D., Miller, K. G., and Bownes, M. (1999) Class VI Unconventional Myosin is Required for Spermatogenesis in Drosophila. Mol. Biol. Cell. 10, 4341-4353.

46. Noguchi, T., Lenartowska, M., and Miller, K. G. (2006) Myosin VI Stabilizes an Actin Network during Drosophila Spermatid Individualization. Mol. Biol. Cell. 17, 2559-2571.

47. Rogat, A. D., and Miller, K. G. (2002) A Role for Myosin VI in Actin Dynamics at Sites of Membrane Remodeling during Drosophila Spermatogenesis. J. Cell. Sci. 115, 4855-4865.

48. Deol, M. S., and Green, M. C. (1966) Snell's Waltzer, a New Mutation Affecting Behaviour and the Inner Ear in the Mouse. Genet. Res. 8, 339-345.

49. Self, T., Sobe, T., Copeland, N. G., Jenkins, N. A., Avraham, K. B., and Steel, K. P. (1999) Role of Myosin VI in the Differentiation of Cochlear Hair Cells. Dev. Biol. 214, 331-341.

50. Hertzano, R., Shalit, E., Rzadzinska, A. K., Dror, A. A., Song, L., Ron, U., Tan, J. T., Shitrit, A. S., Fuchs, H., Hasson, T., Ben-Tal, N., Sweeney, H. L., de Angelis, M. H., Steel, K. P., and Avraham, K. B. (2008) A Myo6 Mutation Destroys Coordination between the Myosin Heads, Revealing New Functions of Myosin VI in the Stereocilia of Mammalian Inner Ear Hair Cells. PLoS Genet. 4, e1000207.

51. Seiler, C., Ben-David, O., Sidi, S., Hendrich, O., Rusch, A., Burnside, B., Avraham, K. B., and Nicolson, T. (2004) Myosin VI is Required for Structural Integrity of the Apical Surface of Sensory Hair Cells in Zebrafish. Dev. Biol. 272, 328-338.

52. Melchionda, S., Ahituv, N., Bisceglia, L., Sobe, T., Glaser, F., Rabionet, R., Arbones, M. L., Notarangelo, A., Di Iorio, E., Carella, M., Zelante, L., Estivill, X., Avraham, K. B., and Gasparini, P. (2001) MYO6, the Human Homologue of the Gene Responsible for Deafness in Snell's Waltzer Mice, is Mutated in Autosomal Dominant Nonsyndromic Hearing Loss. Am. J. Hum. Genet. 69, 635-640.

53. Ahmed, Z. M., Morell, R. J., Riazuddin, S., Gropman, A., Shaukat, S., Ahmad, M. M., Mohiddin, S. A., Fananapazir, L., Caruso, R. C., Husnain, T., Khan, S. N., Riazuddin, S., Griffith, A. J., Friedman, T. B., and Wilcox, E. R. (2003) Mutations of MYO6 are Associated with Recessive Deafness, DFNB37. Am. J. Hum. Genet. 72, 1315-1322.

54. Mohiddin, S. A., Ahmed, Z. M., Griffith, A. J., Tripodi, D., Friedman, T. B., Fananapazir, L., and Morell, R. J. (2004) Novel Association of Hypertrophic Cardiomyopathy, Sensorineural Deafness, and a Mutation in Unconventional Myosin VI (MYO6). J. Med. Genet. 41, 309-314.

55. Ching, Y. H., Ghosh, T. K., Cross, S. J., Packham, E. A., Honeyman, L., Loughna, S., Robinson, T. E., Dearlove, A. M., Ribas, G., Bonser, A. J., Thomas, N. R., Scotter, A. J., Caves, L. S., Tyrrell, G. P., Newbury-Ecob, R. A., Munnich, A., Bonnet, D., and Brook, J. D. (2005) Mutation in Myosin Heavy Chain 6 Causes Atrial Septal Defect. Nat. Genet. 37, 423-428.

56. Dunn, T. A., Chen, S., Faith, D. A., Hicks, J. L., Platz, E. A., Chen, Y., Ewing, C. M., Sauvageot, J., Isaacs, W. B., De Marzo, A. M., and Luo, J. (2006) A Novel Role of Myosin VI in Human Prostate Cancer. Am. J. Pathol. 169, 1843-1854.

57. Puri, C., Chibalina, M. V., Arden, S. D., Kruppa, A. J., Kendrick-Jones, J., and Buss, F. (2010) Overexpression of Myosin VI in Prostate Cancer Cells Enhances PSA and VEGF Secretion, but has no Effect on Endocytosis. Oncogene. 29, 188-200.

58. Buss, F., and Kendrick-Jones, J. (2008) How are the Cellular Functions of Myosin VI Regulated within the Cell? Biochem. Biophys. Res. Commun. 369, 165-175.

59. Warner, C. L., Stewart, A., Luzio, J. P., Steel, K. P., Libby, R. T., Kendrick-Jones, J., and Buss, F. (2003) Loss of Myosin VI Reduces Secretion and the Size of the Golgi in Fibroblasts from Snell's Waltzer Mice. EMBO J. 22, 569-579.

60. Au, J. S., Puri, C., Ihrke, G., Kendrick-Jones, J., and Buss, F. (2007) Myosin VI is Required for Sorting of AP-1B-Dependent Cargo to the Basolateral Domain in Polarized MDCK Cells. J. Cell Biol. 177, 103-114.

61. Sahlender, D. A., Roberts, R. C., Arden, S. D., Spudich, G., Taylor, M. J., Luzio, J. P., Kendrick-Jones, J., and Buss, F. (2005) Optineurin Links Myosin VI to the Golgi Complex and is Involved in Golgi Organization and Exocytosis. J. Cell Biol. 169, 285-295.

62. Puri, C. (2009) Loss of Myosin VI no Insert Isoform (NoI) Induces a Defect in Clathrin-Mediated Endocytosis and Leads to Caveolar Endocytosis of Transferrin Receptor. J. Biol. Chem. 284, 34998-35014.

63. Gotoh, N., Yan, Q., Du, Z., Biemesderfer, D., Kashgarian, M., Mooseker, M. S., and Wang, T. (2010) Altered Renal Proximal Tubular Endocytosis and Histology in Mice Lacking Myosin-VI. Cytoskeleton (Hoboken). 67, 178-192.

64. Wu, H., Nash, J. E., Zamorano, P., and Garner, C. C. (2002) Interaction of SAP97 with Minus-End-Directed Actin Motor Myosin VI. Implications for AMPA Receptor Trafficking. J. Biol. Chem. 277, 30928-30934.

65. Nash, J. E., Appleby, V. J., Correa, S. A., Wu, H., Fitzjohn, S. M., Garner, C. C., Collingridge, G. L., and Molnar, E. (2010) Disruption of the Interaction between Myosin VI and SAP97 is Associated with a Reduction in the Number of AMPARs at Hippocampal Synapses. J. Neurochem. 112, 677-690.

66. Aschenbrenner, L., Lee, T., and Hasson, T. (2003) Myo6 Facilitates the Translocation of Endocytic Vesicles from Cell Peripheries. Mol. Biol. Cell. 14, 2728-2743.

67. Aschenbrenner, L., Naccache, S. N., and Hasson, T. (2004) Uncoated Endocytic Vesicles Require the Unconventional Myosin, Myo6, for Rapid Transport through Actin Barriers. Mol. Biol. Cell. 15, 2253-2263.

68. Morris, C. A., Wells, A. L., Yang, Z., Chen, L. Q., Baldacchino, C. V., and Sweeney, H. L. (2003) Calcium Functionally Uncouples the Heads of Myosin VI. J. Biol. Chem. 278, 23324-23330.

69. Morris, S. M., Arden, S. D., Roberts, R. C., Kendrick-Jones, J., Cooper, J. A., Luzio, J. P., and Buss, F. (2002) Myosin VI Binds to and Localises with Dab2, Potentially Linking Receptor-Mediated Endocytosis and the Actin Cytoskeleton. Traffic. 3, 331-341.

70. Mishra, S. K., Keyel, P. A., Hawryluk, M. J., Agostinelli, N. R., Watkins, S. C., and Traub, L. M. (2002) Disabled-2 Exhibits the Properties of a Cargo-Selective Endocytic Clathrin Adaptor. EMBO J. 21, 4915-4926.

71. Oleinikov, A. V., Zhao, J., and Makker, S. P. (2000) Cytosolic Adaptor Protein Dab2 is an Intracellular Ligand of Endocytic Receptor gp600/megalin. Biochem. J. 347 Pt 3, 613-621.

72. Spudich, G., Chibalina, M. V., Au, J. S., Arden, S. D., Buss, F., and Kendrick-Jones, J. (2007) Myosin VI Targeting to Clathrin-Coated Structures and Dimerization is Mediated by Binding to Disabled-2 and PtdIns(4,5)P2. Nat. Cell Biol. 9, 176-183.

73. Collaco, A., Jakab, R., Hegan, P., Mooseker, M., and Ameen, N. (2010) Alpha-AP-2 Directs Myosin VI-Dependent Endocytosis of Cystic Fibrosis Transmembrane Conductance Regulator Chloride Channels in the Intestine. J. Biol. Chem. 285, 17177-17187.

74. Naccache, S. N., Hasson, T., and Horowitz, A. (2006) Binding of Internalized Receptors to the PDZ Domain of GIPC/synectin Recruits Myosin VI to Endocytic Vesicles. Proc. Natl. Acad. Sci. U. S. A. 103, 12735-12740.

75. Morriswood, B., Ryzhakov, G., Puri, C., Arden, S. D., Roberts, R., Dendrou, C., Kendrick-Jones, J., and Buss, F. (2007) T6BP and NDP52 are Myosin VI Binding Partners with Potential Roles in Cytokine Signalling and Cell Adhesion. J. Cell. Sci. 120, 2574-2585.

76. Maddugoda, M. P., Crampton, M. S., Shewan, A. M., and Yap, A. S. (2007) Myosin VI and Vinculin Cooperate during the Morphogenesis of Cadherin Cell Cell Contacts in Mammalian Epithelial Cells. J. Cell Biol. 178, 529-540.

77. Vreugde, S., Ferrai, C., Miluzio, A., Hauben, E., Marchisio, P. C., Crippa, M. P., Bussi, M., and Biffo, S. (2006) Nuclear Myosin VI Enhances RNA Polymerase II-Dependent Transcription. Mol. Cell. 23, 749-755.