Phenotypic Mutation 'Muskatenwein'

• Allele: Muskatenwein
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 141,753,439 bp (GRCm38)
• Base Change: T ⇒ A (forward strand)
• Gene: Muc2
• Gene Name: mucin 2
• Synonym(s): 2010015E03Rik
• Chromosomal Location: 141,690,340-141,754,693 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016] ; PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000026590; Gene: ENSMUSG00000025515; AA Change: I336N

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

• Predicted Effect: unknown
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.086)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Live Mice, Sperm
• MMRRC Submission: 032797-UCD
• Last Updated: 2017-09-13 3:38 PM by Diantha La Vine
• Record Created: 2009-11-09 12:00 AM
• Record Posted: 2010-03-31
• Science Writers: Nora G. Smart
• Illustrators: Nora G. Smart, Diantha La Vine
• Authors: Katharina Brandl, Bruce Beutler

Accession Number

NCBI RefSeq: NM_023566, MGI: 1339364

Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(2) Chemically induced(4)

Phenotypic Description

The semidominant Muskatenwein phenotype was identified among ENU-mutagenized G3 mice in a screen for mutants with susceptibility to dextran sulfate sodium (DSS)-induced colitis (DSS-induced Colitis Screen).  When challenged with a low dose of DSS in their drinking water (1%), the index mouse (#48) showed severe bleeding and increased weight loss relative to wild type C57BL/6J mice on day 6 and day 7 of DSS exposure (Figure 1).    

Nature of Mutation

Whole genome sequencing of a heterozygous Muskatenwein mouse using the SOLiD technique identified a T to A transversion at base pair 148939344 on Chromosome 7 located in the Muc2 gene using NCBI m37 mouse assembly (Build 37.1). The mutation was confirmed using standard Sanger sequencing (Figure 2), and corresponds to nucleotide 6506 of the Muc2 transcript in exon 44 of 47 coding exons (1). 

 

6490 ATCAACAACCAGCTCATCTCCTCGGTCTCCAAC

2167 -I--N--N--Q--L--I--S--S--V--S--N-

 

The mutated nucleotide is indicated in red lettering, and causes an isoleucine to asparagine change at amino acid 2172 according to the NP_076055 record and amino acid 2533 according to Uniprot record Q80Z19. 

Protein Prediction

Figure 3.  Domain structure of Mucin2. The Muskatenwein mutation alters an isoleucine residue located near the C-terminal end of the protein between the C domain and the cysteine knot (CK) domain. S=Signal sequence; D=D domains (homology to VWF mediates trimerization); CR=Cystein-rich domain; TR= Tandem repeat domain (heavily O glycosylated); GDPH=GDPH autocatalytic proteolytic site; B=B domain (homology to VWF); C= C domain (homology to VWF); CK= Cysteine-knot domain (homology to VWF mediates dimerization). This image is interactive. Click on the image to view other mutations found in Mucin2 (red). Click on the mutations for more specific information.

The Muskatenwein mutation alters an isoleucine residue located near the C-terminal end of the protein between the C domain and the cysteine knot (CK) domain (Figure 3). 

 

For more information about Muc2, please see the record for Schlendrian.

Putative Mechanism

The DSS-induced colitis found in Muskatenwein animals remains unmapped, but this phenotype is similar if less severe to the phenotypes seen in mice carrying missense Muc2 mutations (see the records for Schlendrian, Winnie and Eeyore) (2) and suggests that the Muc2 mutation found in Muskatenwein mice is indeed the phenotype causing mutation. Like other missense mutations in Muc2 and unlike Muc2^-/- animals (2,3), the Muskatenwein phenotype is semidominant suggesting the presence of aberrant protein in these animals. Aberrant MUC2 proteins display abnormal oligomerization and accumulation in the endoplasmic reticulum (ER) leading to ER stress, triggering of the unfolded protein response (UPR), subsequent inflammation and goblet cell apoptosis (2).

 

Although the isoleucine residue altered by the Muskatenwein mutation does not occur in any defined domain, the phenotype of these mice suggests that it is important for MUC2 function. Furthermore, this residue is highly conserved and occurs in a conserved region of the MUC2 protein. The Muskatenwein missense mutation is predicted to be possibly damaging by the PolyPhen(see report). The D3 and CK domains of MUC2 have been implicated in trimerization and dimerization of MUC2 molecules through the formation of disulfide bonds (4-6), and it is possible that altering amino acids located near the CK domain may also affect the biosynthesis and assembly of MUC2 proteins. 

Primers

Primers cannot be located by automatic search.

Genotyping

Muskatenwein genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Musk(F): 5’- AGCAGACCCATTGCATCATCGAG -3’

Musk(R): 5’- TCCTTCATGACGGAGACAGCAGAG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Musk_seq(F): 5’- GATACTCATTCCTGGAGCTAGGAC -3’

Musk_seq(R): 5’- TTTGAGGAACTGAGTCCCAAC -3’

 

The following sequence of 1390 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7 bases 148938628 to 148940017) is amplified:

 

agcagaccca ttgcatcatc gaggggccca agcagcagta cattattctg aaggtgtgtg

cgcttctggc tccacccaca agctaggcag ccactgaggg caaggctagg atgacttcgg

gcttgagtca tcctaaatcc cacatagcat atttgggtgg ctaaaagcaa catatatggt

tgctccactt ctggagctct gaagtgtaag atcaaggctg gcagatgctg tgaggagtcc

ttcctgcctc ttctttgggc tccagccaat tttggtttgt gtttgaatca cctctgatgt

agtagtgtcc ttctatctga gcctgtgcct cctcttctgt ctcttataag gatactcatt

cctggagcta ggacctcctt catgtagggt gacctcatat ccagattatt ttcttgagct

tttcaaagat catttcccca ctcagagtca ctttctagtt cacaagtcag acctaggtta

gagatttctg tgttatgtaa ccacagtagc tatctccaag actgtaacgg atgccacttg

cccagtgact ctggacctcc tttctgtggc gctttgcctc ccaggtcttc ctgggctggc

ctctggcgta cacctgctca tcctcattct gttgcgtcca cagcctgggg agattcacaa

aaaccccagc aacaagtgca ccttcttcag ctgcatgaaa atcaacaacc agctcatctc

ctcggtctcc aacatcacct gtcccgactt caacccaagt gattgtgttt cagtgagtgg

gaccctatgg ccctgtccat gtatgcgttg ccaggagcag ggaaccttaa tgcaccagct

acctggtttc cagggggctt gttccacacc ctcctgtagg acagccctta tgcatcccat

gacaagaagg ggcactcact tgctgggggt gctctggact cctttcttac tctcctttct

cttcagggct ccatcacata catgcctaat ggctgctgta agacatgtga gtacggctgg

ggaaatgttg ggtgatgggt gagttttact cagagccttg aggggaagat gcaggacagg

atgcttcagg actgtgtctc ctacactcat gcagatgtat aggaatctga gtctccttcc

agggagaggc tgggtggagc ccagctgcat gttgggactc agttcctcaa aggaaagtgg

gactcagtta agggctagag acatgctcgg agaaggaaga agaaatggca ccagagaagg

agagggaggg gaagtgggga gagagaggga aggggcaagg ggagctagct agctagagtc

atttttcccc cacaggcatc cctcaaaacc agaccagagt cccttgctct gctgtctccg

tcatgaagga

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

1. Escande, F., Porchet, N., Bernigaud, A., Petitprez, D., Aubert, J. P., and Buisine, M. P. (2004) The Mouse Secreted Gel-Forming Mucin Gene Cluster. Biochim. Biophys. Acta. 1676, 240-250.

2. Heazlewood, C. K., Cook, M. C., Eri, R., Price, G. R., Tauro, S. B., Taupin, D., Thornton, D. J., Png, C. W., Crockford, T. L., Cornall, R. J., Adams, R., Kato, M., Nelms, K. A., Hong, N. A., Florin, T. H., Goodnow, C. C., and McGuckin, M. A. (2008) Aberrant Mucin Assembly in Mice Causes Endoplasmic Reticulum Stress and Spontaneous Inflammation Resembling Ulcerative Colitis. PLoS Med. 5, e54.

3. Van der Sluis, M., De Koning, B. A., De Bruijn, A. C., Velcich, A., Meijerink, J. P., Van Goudoever, J. B., Buller, H. A., Dekker, J., Van Seuningen, I., Renes, I. B., and Einerhand, A. W. (2006) Muc2-Deficient Mice Spontaneously Develop Colitis, Indicating that MUC2 is Critical for Colonic Protection. Gastroenterology. 131, 117-129.

4. Godl, K., Johansson, M. E., Lidell, M. E., Morgelin, M., Karlsson, H., Olson, F. J., Gum, J. R.,Jr, Kim, Y. S., and Hansson, G. C. (2002) The N Terminus of the MUC2 Mucin Forms Trimers that are Held Together within a Trypsin-Resistant Core Fragment. J. Biol. Chem. 277, 47248-47256.

5. Asker, N., Axelsson, M. A., Olofsson, S. O., and Hansson, G. C. (1998) Dimerization of the Human MUC2 Mucin in the Endoplasmic Reticulum is Followed by a N-Glycosylation-Dependent Transfer of the Mono- and Dimers to the Golgi Apparatus. J. Biol. Chem. 273, 18857-18863..

6.  Lidell, M. E., Johansson, M. E., Morgelin, M., Asker, N., Gum, J. R.,Jr, Kim, Y. S., and Hansson, G. C. (2003) The Recombinant C-Terminus of the Human MUC2 Mucin Forms Dimers in Chinese-Hamster Ovary Cells and Heterodimers with Full-Length MUC2 in LS 174T Cells. Biochem. J. 372, 335-345.