Phenotypic Mutation 'nd1'

• Allele: nd1
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 59,565,974 bp (GRCm38)
• Base Change: T ⇒ G (forward strand)
• Gene: Nlrp3
• Gene Name: NLR family, pyrin domain containing 3
• Synonym(s): Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
• Chromosomal Location: 59,541,568-59,566,956 bp (+)
• MGI Phenotype: Strain: 3686871; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Tryptophan
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8R4B8
• SMART Domains: Protein: ENSMUSP00000078440; Gene: ENSMUSG00000032691; AA Change: C987W

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000079476)
• SMART Domains: Protein: ENSMUSP00000098707; Gene: ENSMUSG00000032691; AA Change: C987W

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000101148)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.081)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm, gDNA
• MMRRC Submission: 032646-UCD
• Last Updated: 2019-01-29 1:22 PM by Diantha La Vine
• Record Created: 2009-11-10 12:00 AM
• Record Posted: 2010-05-07
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Hua Huang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_145827; MGI: 2653833

Alleles Listed at MGI

All alleles(10) : Targeted, knock-out(3) Targeted, other(4) Chemically induced(3)

Phenotypic Description

Figure 1.

The ND1 phenotype was initially identified among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU) and tested in the NALP3 Inflammasome Screen (D3891, D3892 and D3893; Figure 1).  Peritoneal macrophages isolated from both ND1 homozygous and heterozygous mice secreted reduced amounts of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1), with heterozygotes producing IL-1β at a level intermediate between that produced by wild type and homozygous macrophages.  ND1 mice produced normal levels of tumor necrosis factor (TNF)-α in response to LPS stimulation alone, suggesting that signaling from the Toll-like receptor 4 (TLR4), which senses LPS, was unimpaired. 

Nature of Mutation

The Nlrp3 gene was directly sequenced as a candidate gene and a T to G transversion was found at position 3187 of the Nlrp3 transcript in exon 9 of 10 total exons using Genbank record NM_145827. The mutation is located in the eighth coding exon.

 

3170 TGCGTGGTGACCCTCTGTGAGGTGCTGAAACAG

982  -C--V--V--T--L--C--E--V--L--K--Q-

 

The mutated nucleotide is indicated in red lettering, and causes a cysteine to tryptophan substitution at residue 987 of the NLRP3 protein.

Protein Prediction

The Nlrp3 gene encodes a 1033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family (1). The structure of NLRs resembles that of a subset of plant disease-resistance (R) proteins that are involved in the hypersensitive response to virulent plant pathogens. Both NLRs and R proteins contain a C-terminal leucine-rich repeat (LRR) domain, a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD), and an N-terminal effector domain. The N-terminus of R proteins often contains a Toll/interleukin-1 receptor (TIR) domain, while NLRP3 contains a pyrin domain (PYD) at this location. Other N-terminal NLR domains include the caspase-recruitment domain (CARD) and the baculovirus inhibitor of apoptosis protein repeat (BIR) (2;3). NLRP3 (NLR family, pyrin domain containing protein 3) is also known as NALP3, PYPAF1 and cryopyrin (1;4). Human and mouse NLRP3 are highly conserved with 82.7% amino acid identity (5;6). 

 

Figure 2. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The nd1 mutation causes a cysteine to tryptophan substitution at residue 987. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The NLRP3 PYD occurs at amino acids 1-91. This domain bears similarity to death domains (DDs), death effector domains (DEDs), and CARDs that are found in many proteins involved in apoptosis and inflammation. All of these domains function in protein-protein interactions and contain an antiparallel six-helical bundle with Greek-key topology and internal pseudo-twofold symmetry. A core of hydrophobic residues forms the core of the pyrin domain fold (7). Pyrin domains are capable of interacting specifically with PYDs found in other proteins, and the PYD of NLRP3 binds to the PYD of apoptosis-associated speck like protein (ASC) (8;9) (see Background).

 

The NACHT domain is a 300 to 400 residue predicted nucleotide triphosphatase (NTPase) domain, which is found in animal, fungal and bacterial proteins. The name NACHT is derived from the four plant and animal proteins which initially defined the unique features of this domain: the neuronal apoptosis inhibitory protein (NAIP), MHC class II transcription activator (CIITA), incompatibility locus protein from Podospora anserina (HET-E), and telomerase-associated protein (TP1). In NLR proteins, the NACHT and NAD, also known as the NBD (nucleotide-binding domain), consists of twelve distinct conserved motifs, including the ATP/GTPase specific P-loop (Walker A motif), and the magnesium (Mg²⁺)-binding site (Walker B motif) (10;11). The Walker A motif contains the sequence GKS/T corresponding to amino acids 227-229 in mouse NLRP3 with the lysine coordinating the γ-phosphate of NTPs (6;12). The unique features of the NACHT domain include the prevalence of small residues (glycine, alanine or serine) directly C-terminal of the Mg²⁺-coordinating aspartate in the Walker B motif, in place of a second acidic residue prevalent in other NTPases. A second acidic residue is typically found in the NACHT-containing proteins two positions downstream. Distal to the Walker A and B motifs, these domains also a conserved pattern of polar, aromatic and hydrophobic residues that is not seen in any other NTPase family (10). Modeling studies of the NLRP3 NACHT domain suggests that it consists of a five-stranded β-sheet surrounded by α-helices with the Walker A, Walker B, and a sensor motif containing a conserved polar residue found at the end of the parallel strands forming the nucleotide-binding site. The NAD extension of the NLRP3 NACHT domain consists of three helical subdomains (13;14). The NACHT domain of NLRP3 specifically displays ATPase activity, and mutation of Walker A and B motifs reduces ATP binding, as well as NLRP3 protein function including caspase-1 activation, IL-1β production, cell death, macromolecular complex formation, self-association, and association with ASC (see Background). Disruption of nucleotide binding also abolishes the constitutive activation of disease-associated mutants (12). The mouse NLRP3 NBD comprises amino acids 216-532.  

 

LRR-containing domains generally consist of 2-45 motifs of 20-30 amino acids in length, which are predicted to fold into an arc or horseshoe shape (15). LRRs occur in proteins ranging from viruses to eukaryotes, and appear to provide a structural framework for the formation of protein-protein interactions. Proteins containing LRRs include tyrosine kinase receptors, cell-adhesion molecules, virulence factors, and extracellular matrix-binding glycoproteins, and are involved in a variety of biological processes, including signal transduction, cell adhesion, DNA repair, recombination, transcription, RNA processing, disease resistance, apoptosis, and the immune response where they are suggested to bind to and sense molecules that trigger inflammation (2). Sequence analyses of LRR proteins suggests the existence of several different subfamilies of LRRs (16), but all major classes of LRRs have curved horseshoe structures with a parallel β-sheet on the concave side and mostly helical elements on the convex side. Eleven-residue segments of the LRRs (LxxLxLxxN/CxL), corresponding to the β-strand and adjacent loop regions, are conserved in LRR proteins, whereas the remaining parts of the repeats may be very different. Despite the differences, each of the variable parts contains two half-turns at both ends and a "linear" segment, usually formed by a helix, in the middle. The concave face and the adjacent loops are the most common protein interaction surfaces on LRR proteins. 3D structures of some LRR proteins-ligand complexes show that the concave surface of LRR domain is ideal for interaction with α-helical structures. Molecular modeling suggests that the conserved pattern LxxLxL, which is shorter than the previously proposed LxxLxLxxN/CxL, is sufficient to impart the characteristic horseshoe curvature to proteins with 20- to 30-residue repeats (15;17). The LRR-containing domain of NLRP3 is thought to bind to the NBD domain preventing oligomerization and protein activation (2), but has also been shown to associate with thioredoxin-interacting protein (TXNIP) (18).

 

It is not clear how many LRRs NLRP3 contains as anywhere from seven to twelve have been reported for mouse and human proteins (4-6;9). Both human and mouse NLRP3 undergo extensive alternative splicing of coding exons 4-9, resulting in mRNAs of varying sizes detected in peripheral blood leukocyte cDNA (5;6). 

 

The ND1 mutation results in a cysteine to tryptophan change in coding exon 8. Depending on the prediction program used, this residue may occur in the second to last LRR, the final LRR, or falls just outside the LRR domain.

Expression/Localization

In mice, Nlrp3 mRNA is detectable using RT-PCR analysis in all tissues examined, except the thymus (19). Particularly high levels were reported in the eye and skin, as well as peripheral blood leukocytes (6;9). Nlrp3 mRNA is expressed in a variety of resting immune cells, including macrophages, dendritic cells, and neutrophils, and is seen at low levels in B cells and T cells (6;19;20). The expression of Nlrp3 mRNA was upregulated in a subset of helper T cells (Th2), while expression in macrophages is increased by LPS stimulation (19). In murine lungs infected with influenza virus, Nlrp3 mRNA is also detectable in mouse airway epithelial cells (20), and NLRP3 protein is detectable in pancreatic islet cells (18).

 

Unlike in mice, Northern blot analysis of human tissues found NLRP3 mRNA restricted to peripheral blood leukocytes (5). Human NLRP3 mRNA is also increased by TLR agonists (21). Both mouse and human osteoblasts express NLRP3 mRNA (22). In human immune cells, NLRP3 protein is detected in granulocytes, dendritic cells, B and T lymphocytes, and very weakly in monocytes. In other tissues, NLRP3 expression is mainly restricted to non-keratinizing epithelia in the oropharynx, esophagus, and ectodermic, and is found in the urothelial layer in the bladder. NLRP3 is predominantly cytoplasmic (23).

Background

Certain members of the NLR family, including IPAF (ICE protease-activating factor), NLRP1b, and NLRP3, are able to oligomerize through their NBD domains and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. Initially, NLRP3 was shown to assemble a 700kDa, caspase-1 activating complex under certain in vitro conditions (24). Caspase-1 is a cysteine protease that is present under resting conditions in an inactive precursor form with an N-terminal CARD-containing prodomain capable of mediating homotypic interactions. The CARD domain of procaspase-1 recruits the protease to the inflammasome where it undergoes autoproteolytic maturation into its active form. Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes in by activating key processes such as the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK) pathways The adaptor protein ASC plays an important role in inflammasome assembly by binding to the NLRP3 PYD through its own PYD, and then recruiting procaspase-1 to the complex through its CARD domain [reviewed by (25)]. Another CARD-containing adaptor protein, human CARDINAL, has been shown to be part of a reconstituted human NLRP3 inflammasome, but the functional role for this protein is unclear as no murine homolog for CARDINAL has been identified (26). The association of NLRP3 with a molecular chaperone complex consisting of HSP90 and the ubiquitin ligase–associated protein SGT may also be important for the assembly of the NLRP3 inflammasome (27).

 

Figure 3. NLRP3 inflammasome pathway. NLRP3 is present in the cytosol in an inactive conformation state due to its association with the SGT1/HSP90 chaperone complex. The NLRP3 inflammasome is activated by a wide variety of agents. Several activators have been shown to generate pore formation by a pannexin hemichannel that may allow extracellular molecules access to the cytoplasm and contact with NLRP3. Extracellular ATP mediates inflammasome activation through the P2X7 ATP-gated ion channel, triggering rapid K⁺ efflux from the cell (decreased potassium (K⁺) concentration may favor inflammasome assembly). Rupture of lysosomes containing certain particulates releases Cathepsin B into the cytoplasm, activating the inflammasome. NLRP3 activators may also trigger inflammasome assembly by generating reactive oxygen species (ROS), often produced under situations of cellular stress. The inactive state of caspase-1 contains a CARD-containing prodomain. Oligomerization of NLRP3 and the recruitment of caspase-1, ASC, and CARDINAL leads to the autoproteolytic maturation of caspase-1. Caspase-1 is capable of cleaving pro-1L-1β, pro-IL-18, and pro-IL-33. These mature cytokines mediate a variety of biological effects by activating key processes such as the nuclear factor κB and mitogen-activated protein kinase (MAPK) pathways.   

Unlike the IPAF and NLRP1b inflammasomes that assemble in response to a relatively few known stimuli (25), the NLRP3 inflammasome has now been shown to be activated in response to diverse agents that include pathogens, DNA, single-stranded (ss) RNA, double-stranded (ds) RNA, bacterial toxins, environmental irritants as well as endogenous danger signals [reviewed by (3;28)] (Table 1). The diversity of these molecules suggests that many of them are likely to activate the NLRP3 inflammasome indirectly through convergent mechanisms, and many NLRP3 activators generate several common cellular events. One of these is a decrease in cytoplasmic potassium (K⁺) concentration (29;30). The mechanism behind this effect is not known, but low K⁺ may favor inflammasome assembly. In addition, several activators have been shown to generate pore formation by a pannexin hemichannel that may allow extracellular molecules access to the cytoplasm and contact with NLRP3 [reviewed by (3)]. Extracellular ATP released at sites of cellular injury or necrosis, mediates inflammasome activation through the P2X7 ATP-gated ion channel, triggering rapid K⁺ efflux from the cell and recruitment and pore formation by Pannexin 1 (31). Similarly, pore formation by various toxins may allow the entry of NLRP3 activators into the cell and K⁺ efflux (29). However, many NLRP3 activators are far too large to enter the cell in this manner. Multiple studies suggest that phagocytosis of particulates like MSU, silica, asbestos and alum is necessary for their activation of the NLRP3 inflammasome (32-36). Inefficient clearance of the activating particle then leads to phagosomal destabilization, lysosomal rupture and release of the lysosomal protein cathepsin B into the cytoplasm, triggering inflammasome activation by an unknown mechanism. However, it is unclear whether cathepsin B release is strictly necessary for NLRP3 activation (3). Finally, NLRP3 activators may also trigger inflammasome assembly via the generation of reactive oxygen species (ROS), which are often produced under situations of cellular stress. All NLRP3 activators that have been examined produce short-lived ROS, and treatment with various ROS scavengers can block NLRP3 activation (30;34). NLRP3 binding to TXNIP (see Protein Prediction) occurs in a ROS-dependent manner, and links inflammasome activity to the pathogenesis of type 2 diabetes mellitus (18;28)

 

Table 1. NLRP3 inflammasome activators

 

Activator Class	Activator	Disease Associations	Proposed signaling pathway	Refs
Whole microbes	Sendai virus	Infection	?	(37)
	Influenza virus	Infection	ROS and lysosomal rupture	(20;37;38)
	Adenovirus	Infection	ROS	(39)
	Candida albicans	Infection	ROS	(40-42)
	Saccaromyces cerevisiae	Infection	ROS	(40)
	Staphylococcus aureus	Infection	ROS	(43)
	Listeria monocytogenes	Infection	ROS	(29;44)
	Shigella flexneri	Infection	Lysosomal rupture	(45)
Microbe-associated molecules	Bacterial pore-forming toxins (aerolysin,maitotoxin nigericin, listeriolysin, Mycobacterium tuberculosis protein ESAT-6)	Infection	ROS and pannexin channel formation	(29;46-48)
	Hemozoin	Cerebral malaria	ROS	(49)
Endogenous signals	Extracellular ATP	Injury or necrotic cell death	ROS and pannexin channel formation	(30;31;50)
	Hyaluronan	Injury	Lysosomal rupture	(51)
	Glucose	Metabolic syndrome	ROS	(18)
	Monosodium urate (MSU)	Gout	ROS	(30;32)
	Calcium pyrophosphate dehydrate (CPPD)	Pseudogout	ROS	(30;32)
	Amyloid-β	Alzheimer’s disease	Lysosomal rupture	(36)
Environmental irritants	Skin irritants	Contact hypersensitivity	ROS	(19;52)
	UV light	Sunburn	ROS	(53)
	Imidazoquinoline compounds	Antiviral treatment	ROS	(37)
	Silica	Silicosis	ROS and lysosomal rupture	(33-35)
	Asbestos	Asbestosis	ROS and lysosomal rupture	(34)
	Adjuvants (alum, QuilA, chitosan)	Vaccines	ROS and lysosomal rupture	(35;54;55)

 

 

Most studies have focused on the role of NLRP3 in immune cells due to the importance of the inflammasome in the innate immune system. However, other cell types and tissues also appear to initiate inflammation by activating NLRP3, including skin keratinocytes (19;52;53), and insulin-producing pancreatic β-cells (18). Interestingly, various immune cells differentially regulate the synthesis, processing and release of IL-1β. Macrophages first require an inflammatory stimulus (TLR ligand) to induce large intracellular stores of pro-IL-1β, followed by a second stimulus, such as extracellular ATP or bacterial toxins, resulting in activation of the NLRP3 inflammasome and release of active, mature IL-1β (19;56). Monocytes, however, only require stimulation with TLR ligands since they possess a constitutively activated caspase-1 (56). Effector and memory CD4⁺ T cells can suppress potentially damaging inflammation caused by inflammasome activity (57).

 

A total of 93 disease-associated mutations have been found in humans in the NLRP3 gene according to the Infevers database, an online database for autoinflammatory mutations (58-60). These mutations cause a range of phenotypes that encompass three autoinflammatory disorders: Muckle-Wells syndrome (MWS; #191900), familial cold autoinflammatory syndrome (FCAS1; OMIM #120100), and chronic infantile neurologic cutaneous and articular syndrome (CINCA; OMIM #607115), also known as NOMID for neonatal onset multisystem inflammatory disease (5;61;62). Collectively, these diseases are known as cryopyrin associated periodic syndrome (CAPS). CINCA syndrome is a severe chronic inflammatory disease of early onset, characterized by cutaneous symptoms, central nervous system involvement, and arthropathy (62). Familial cold autoinflammatory syndrome is characterized clinically by recurrent attacks of a maculopapular rash associated with arthralgias, myalgias, fever and chills, and swelling of the extremities after exposure to cold.  Muckle-Wells syndrome (MWS) is characterized by episodic skin rash, arthralgias, and fever associated with late-onset sensorineural deafness and renal amyloidosis (61). The vast majority of NLRP3 mutations causing these diseases are missense mutations, and most of them are found in the central coding exon 3 encoding the NBD and surrounding sequence with clustering occurring on one side of domain along the nucleotide-binding cleft in loops next to the parallel β-strands forming the NACHT domain (13;14). This region is predicted to be involved in intermolecular contacts. Human NLRP3 mutations result in enhanced inflammasome sensitivity and activity leading to elevated levels of IL-1β, and these diseases are often treated by IL-1β inhibitors (63;64). Recently, polymorphisms in regulatory elements that cause decreased NLRP3 expression and IL-1β production were linked with increased susceptibility to Crohn’s disease (OMIM #266600) (65).  

 

Macrophages from Nlrp3 knockout mice display deficient responses to stimuli that normally activates the NLRP3 inflammasome, and display decreased secretion of IL-1β and IL-18 (19;29;32;37). Accordingly, NLRP3-deficient animals are more susceptible to various pathogenic organisms including influenza (20;38), adenovirus (39), and C. albicans (41;42). Mice carrying mutations corresponding to activating human NLRP3 variants have also been generated (66;67). These animals display spontaneous autoinflammatory disease, although the symptoms appear more severe than in humans, ranging from severe skin inflammation with neutrophilic infiltration associated with poor health (67) to widespread inflammation of many organs and death before weaning (66). Genetic background may contribute to disease severity. Examination of inflammasome activity in these animals showed a hypersensitive response and increased production of proinflammatory cytokines in response to NLRP3 stimuli. Most of the amino acids where human disease-causing mutations occur are conserved in the mouse (6). 

Putative Mechanism

None of the activating human NLRP3 mutations occur in coding exon 8 where the ND1 mutation occurs, and the ND1 mutation in mice is likely to be an inactivating rather than an activating mutation of Nlrp3. ND1 mice have not been tested in vivo for immunodeficient or autoimmune phenotypes, but macrophages from these animals are not responsive to NLRP3 activators, suggesting that the NLRP3 protein in these animals, if expressed, is inactive or has reduced activity. There are no known inactivating mutations in NLRP3 in humans, although mutations in the regulatory regions of the NLRP3 gene are associated with reduced NLRP3 expression and Crohn’s disease (65). The vast majority of the activating mutations that cause autoinflammatory disorders reside in exon 3, which encodes the NBD and surrounding sequences. These data strongly suggest that mutation of the NBD, perhaps rendering the protein permanently able to bind to and hydrolyze ATP or unable to bind to the inhibitory LRRs that prevent self-oligomerization, is the basis behind constitutive activation of the protein. Only three mutations have been identified in humans occurring outside of exon 3 that cause disease. Two of these occur in exon 4 and one occurs in exon 6. Both of these exons are predicted to encode LRRs. As the LRRs are thought to bind to the NBD and inhibit inflammasome formation, it is likely that these mutations lead to defective inhibition by the LRRs of the NBD and increased inflammasome activity.

 

The ND1 mutation occurs at amino acid 987 near the C-terminus of the protein. It is unclear whether this residue is located within the LRR domain or not, but may affect the function of the LRR domain. In addition to inhibiting the NBD, the LRRs of NLRP3 may be involved in sensing activating stimuli. The association of the NLRP3 LRR domain with TXNIP, resulting in inflammasome activation, supports this hypothesis (18). Thus, mutation of the LRRs could result in decreased protein activity instead of increased protein activity depending on the residues affected. The mutation of residues important for self-binding may lead to constitutive protein activation, while mutating residues that are important in binding to other molecules may lead to decreased protein function. Alternatively, mutations in these regions could disrupt the characteristic structure of the LRR repeats, indirectly affecting protein-protein interactions. The semidominant nature of the ND1 mutation is likely due to the aberrant protein product oligomerizing with wild type protein and rendering the entire inflammasome unresponsive to stimuli.

 

Primers

Primers cannot be located by automatic search.

Genotyping

ND1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

ND1(F): 5’- ACAGCTTAAAGGCTAAGCCCCTGC -3’

ND1(R): 5’- TTCCACGCCTACCAGGAAATCTCG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

ND1 _seq(F): 5'- GGTTGGCTTCGAACTCAGAAATC -3'

ND1 _seq(R): 5’- CTAAGGCACGTTTTGTTTCACG -3’

 

The following sequence of 921 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 59,378,853 to 59,379,774) is amplified:

 

                                                                                acagc ttaaaggcta

agcccctgcc accacagtcc tgccaactgc aaacattcat ttggtccatt gatactttgt

ggaaatctga ggggaacata atgtttagaa aaagtcaatt gacaaatttc tgttactatt

ttggtctgtt caacccagta ccttgggaaa agaaacttcc atctaaagag gggagaaaag

aaaccatatc atatgaagca gcttcacgct ggtcagtctg tggtttgttg ttgttgttgt

tttcaagaca gggtttatct gtgtagccct ggcttgcctg gaactcactc tgtagaccag

gttggcttcg aactcagaaa tccgcctgct tctgcctccc aagtgctggg attaaaggtg

tgcaccacca ctgcccagcc caatctgcgc tttttatgca aatgaaactg caggtttgga

gacccggaag tatggatggt caaggctatt ttctttatat cacccttctc ttctcaaaga

ttagacaact gcagcctcac ctcacacagc tgctggaatc tctccacaat tctgacccac

aaccacagcc ttcggaagct gaacctgggc aacaatgatc ttggcgatct gtgcgtggtg

accctctgtg aggtgctgaa acagcagggc tgcctcctgc agagcctaca gtgagtgtgg

tttgcctaga gcttctcatg gggtaggcga gcggggtgct gaggggaggg tgaccacggg

acaaaagtca gagtttctct ggattaattt gcagttttct gaagagtcca actcaaagct

tcttttctgt gttcacaggt tgggtgaaat gtacttaaat cgtgaaacaa aacgtgcctt

agaagcgctc caggaagaaa agcctgagct gactatagtc ttcgagattt cctggtaggc

gtggaa

       

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

1. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.

2. Ye, Z., and Ting, J. P. (2008) NLR, the Nucleotide-Binding Domain Leucine-Rich Repeat Containing Gene Family. Curr. Opin. Immunol. 20, 3-9.

3. Tschopp, J., and Schroder, K. (2010) NLRP3 Inflammasome Activation: The Convergence of Multiple Signalling Pathways on ROS Production? Nat. Rev. Immunol. 10, 210-215.

4. Lamkanfi, M., and Kanneganti, T. D. (2010) Nlrp3: An Immune Sensor of Cellular Stress and Infection. Int. J. Biochem. Cell Biol.

5. Hoffman, H. M., Mueller, J. L., Broide, D. H., Wanderer, A. A., and Kolodner, R. D. (2001) Mutation of a New Gene Encoding a Putative Pyrin-Like Protein Causes Familial Cold Autoinflammatory Syndrome and Muckle-Wells Syndrome. Nat. Genet. 29, 301-305.

6. Anderson, J. P., Mueller, J. L., Rosengren, S., Boyle, D. L., Schaner, P., Cannon, S. B., Goodyear, C. S., and Hoffman, H. M. (2004) Structural, Expression, and Evolutionary Analysis of Mouse CIAS1. Gene. 338, 25-34.

7. Fairbrother, W. J., Gordon, N. C., Humke, E. W., O'Rourke, K. M., Starovasnik, M. A., Yin, J. P., and Dixit, V. M. (2001) The PYRIN Domain: A Member of the Death Domain-Fold Superfamily. Protein Sci. 10, 1911-1918.

8. Martinon, F., Hofmanndouble, d. K., and Tschopp, J. (2001) The Pyrin Domain: A Possible Member of the Death Domain-Fold Family Implicated in Apoptosis and Inflammation. Curr. Biol. 11, R118-R120.

9. Manji, G. A., Wang, L., Geddes, B. J., Brown, M., Merriam, S., Al-Garawi, A., Mak, S., Lora, J. M., Briskin, M., Jurman, M., Cao, J., DiStefano, P. S., and Bertin, J. (2002) PYPAF1, a PYRIN-Containing Apaf1-Like Protein that Assembles with ASC and Regulates Activation of NF-Kappa B. J. Biol. Chem. 277, 11570-11575.

10. Koonin, E. V., and Aravind, L. (2000) The NACHT Family - a New Group of Predicted NTPases Implicated in Apoptosis and MHC Transcription Activation. Trends Biochem. Sci. 25, 223-224.

11. Harton, J. A., Linhoff, M. W., Zhang, J., and Ting, J. P. (2002) Cutting Edge: CATERPILLER: A Large Family of Mammalian Genes Containing CARD, Pyrin, Nucleotide-Binding, and Leucine-Rich Repeat Domains. J. Immunol. 169, 4088-4093.

12. Duncan, J. A., Bergstralh, D. T., Wang, Y., Willingham, S. B., Ye, Z., Zimmermann, A. G., and Ting, J. P. (2007) Cryopyrin/NALP3 Binds ATP/dATP, is an ATPase, and Requires ATP Binding to Mediate Inflammatory Signaling. Proc. Natl. Acad. Sci. U. S. A. 104, 8041-8046.

13. Neven, B., Callebaut, I., Prieur, A. M., Feldmann, J., Bodemer, C., Lepore, L., Derfalvi, B., Benjaponpitak, S., Vesely, R., Sauvain, M. J., Oertle, S., Allen, R., Morgan, G., Borkhardt, A., Hill, C., Gardner-Medwin, J., Fischer, A., and de Saint Basile, G. (2004) Molecular Basis of the Spectral Expression of CIAS1 Mutations Associated with Phagocytic Cell-Mediated Autoinflammatory Disorders CINCA/NOMID, MWS, and FCU. Blood. 103, 2809-2815.

14. Albrecht, M., Domingues, F. S., Schreiber, S., and Lengauer, T. (2003) Structural Localization of Disease-Associated Sequence Variations in the NACHT and LRR Domains of PYPAF1 and NOD2. FEBS Lett. 554, 520-528.

15. Enkhbayar, P., Kamiya, M., Osaki, M., Matsumoto, T., and Matsushima, N. (2004) Structural Principles of Leucine-Rich Repeat (LRR) Proteins. Proteins. 54, 394-403.

16. Kajava, A. V. (1998) Structural Diversity of Leucine-Rich Repeat Proteins. J. Mol. Biol. 277, 519-527.

17. Kajava, A. V., and Kobe, B. (2002) Assessment of the Ability to Model Proteins with Leucine-Rich Repeats in Light of the Latest Structural Information. Protein Sci. 11, 1082-1090.

18. Zhou, R., Tardivel, A., Thorens, B., Choi, I., and Tschopp, J. (2010) Thioredoxin-Interacting Protein Links Oxidative Stress to Inflammasome Activation. Nat. Immunol. 11, 136-140.

19. Sutterwala, F. S., Ogura, Y., Szczepanik, M., Lara-Tejero, M., Lichtenberger, G. S., Grant, E. P., Bertin, J., Coyle, A. J., Galan, J. E., Askenase, P. W., and Flavell, R. A. (2006) Critical Role for NALP3/CIAS1/Cryopyrin in Innate and Adaptive Immunity through its Regulation of Caspase-1. Immunity. 24, 317-327.

20. Allen, I. C., Scull, M. A., Moore, C. B., Holl, E. K., McElvania-TeKippe, E., Taxman, D. J., Guthrie, E. H., Pickles, R. J., and Ting, J. P. (2009) The NLRP3 Inflammasome Mediates in Vivo Innate Immunity to Influenza A Virus through Recognition of Viral RNA. Immunity. 30, 556-565.

21. O'Connor, W.,Jr, Harton, J. A., Zhu, X., Linhoff, M. W., and Ting, J. P. (2003) Cutting Edge: CIAS1/cryopyrin/PYPAF1/NALP3/CATERPILLER 1.1 is an Inducible Inflammatory Mediator with NF-Kappa B Suppressive Properties. J. Immunol. 171, 6329-6333.

22. McCall, S. H., Sahraei, M., Young, A. B., Worley, C. S., Duncan, J. A., Ting, J. P., and Marriott, I. (2008) Osteoblasts Express NLRP3, a Nucleotide-Binding Domain and Leucine-Rich Repeat Region Containing Receptor Implicated in Bacterially Induced Cell Death. J. Bone Miner. Res. 23, 30-40.

23. Kummer, J. A., Broekhuizen, R., Everett, H., Agostini, L., Kuijk, L., Martinon, F., van Bruggen, R., and Tschopp, J. (2007) Inflammasome Components NALP 1 and 3 show Distinct but Separate Expression Profiles in Human Tissues Suggesting a Site-Specific Role in the Inflammatory Response. J. Histochem. Cytochem. 55, 443-452.

24.Martinon, F., Agostini, L., Meylan, E., and Tschopp, J. (2004) Identification of Bacterial Muramyl Dipeptide as Activator of the NALP3/cryopyrin Inflammasome. Curr. Biol. 14, 1929-1934.

25. Lamkanfi, M., and Dixit, V. M. (2009) Inflammasomes: Guardians of Cytosolic Sanctity. Immunol. Rev. 227, 95-105.

26. Agostini, L., Martinon, F., Burns, K., McDermott, M. F., Hawkins, P. N., and Tschopp, J. (2004) NALP3 Forms an IL-1beta-Processing Inflammasome with Increased Activity in Muckle-Wells Autoinflammatory Disorder. Immunity. 20, 319-325.

27. Mayor, A., Martinon, F., De Smedt, T., Petrilli, V., and Tschopp, J. (2007) A Crucial Function of SGT1 and HSP90 in Inflammasome Activity Links Mammalian and Plant Innate Immune Responses. Nat. Immunol. 8, 497-503.

28. Schroder, K., Zhou, R., and Tschopp, J. (2010) The NLRP3 Inflammasome: A Sensor for Metabolic Danger? Science. 327, 296-300.

29. Mariathasan, S., Weiss, D. S., Newton, K., McBride, J., O'Rourke, K., Roose-Girma, M., Lee, W. P., Weinrauch, Y., Monack, D. M., and Dixit, V. M. (2006) Cryopyrin Activates the Inflammasome in Response to Toxins and ATP. Nature. 440, 228-232.

30. Petrilli, V., Papin, S., Dostert, C., Mayor, A., Martinon, F., and Tschopp, J. (2007) Activation of the NALP3 Inflammasome is Triggered by Low Intracellular Potassium Concentration. Cell Death Differ. 14, 1583-1589.

31. Pelegrin, P., and Surprenant, A. (2006) Pannexin-1 Mediates Large Pore Formation and Interleukin-1beta Release by the ATP-Gated P2X7 Receptor. EMBO J. 25, 5071-5082.

32. Martinon, F., Petrilli, V., Mayor, A., Tardivel, A., and Tschopp, J. (2006) Gout-Associated Uric Acid Crystals Activate the NALP3 Inflammasome. Nature. 440, 237-241.

33. Cassel, S. L., Eisenbarth, S. C., Iyer, S. S., Sadler, J. J., Colegio, O. R., Tephly, L. A., Carter, A. B., Rothman, P. B., Flavell, R. A., and Sutterwala, F. S. (2008) The Nalp3 Inflammasome is Essential for the Development of Silicosis. Proc. Natl. Acad. Sci. U. S. A. 105, 9035-9040.

34. Dostert, C., Petrilli, V., Van Bruggen, R., Steele, C., Mossman, B. T., and Tschopp, J. (2008) Innate Immune Activation through Nalp3 Inflammasome Sensing of Asbestos and Silica. Science. 320, 674-677.

35. Hornung, V., Bauernfeind, F., Halle, A., Samstad, E. O., Kono, H., Rock, K. L., Fitzgerald, K. A., and Latz, E. (2008) Silica Crystals and Aluminum Salts Activate the NALP3 Inflammasome through Phagosomal Destabilization. Nat. Immunol. 9, 847-856.

36. Halle, A., Hornung, V., Petzold, G. C., Stewart, C. R., Monks, B. G., Reinheckel, T., Fitzgerald, K. A., Latz, E., Moore, K. J., and Golenbock, D. T. (2008) The NALP3 Inflammasome is Involved in the Innate Immune Response to Amyloid-Beta. Nat. Immunol. 9, 857-865.

37. Kanneganti, T. D., Body-Malapel, M., Amer, A., Park, J. H., Whitfield, J., Franchi, L., Taraporewala, Z. F., Miller, D., Patton, J. T., Inohara, N., and Nunez, G. (2006) Critical Role for Cryopyrin/Nalp3 in Activation of Caspase-1 in Response to Viral Infection and Double-Stranded RNA. J. Biol. Chem. 281, 36560-36568.

38. Thomas, P. G., Dash, P., Aldridge, J. R.,Jr, Ellebedy, A. H., Reynolds, C., Funk, A. J., Martin, W. J., Lamkanfi, M., Webby, R. J., Boyd, K. L., Doherty, P. C., and Kanneganti, T. D. (2009) The Intracellular Sensor NLRP3 Mediates Key Innate and Healing Responses to Influenza A Virus Via the Regulation of Caspase-1. Immunity. 30, 566-575.

39. Muruve, D. A., Petrilli, V., Zaiss, A. K., White, L. R., Clark, S. A., Ross, P. J., Parks, R. J., and Tschopp, J. (2008) The Inflammasome Recognizes Cytosolic Microbial and Host DNA and Triggers an Innate Immune Response. Nature. 452, 103-107.

40. Kumar, H., Kumagai, Y., Tsuchida, T., Koenig, P. A., Satoh, T., Guo, Z., Jang, M. H., Saitoh, T., Akira, S., and Kawai, T. (2009) Involvement of the NLRP3 Inflammasome in Innate and Humoral Adaptive Immune Responses to Fungal Beta-Glucan. J. Immunol. 183, 8061-8067.

41. Joly, S., Ma, N., Sadler, J. J., Soll, D. R., Cassel, S. L., and Sutterwala, F. S. (2009) Cutting Edge: Candida Albicans Hyphae Formation Triggers Activation of the Nlrp3 Inflammasome. J. Immunol. 183, 3578-3581.

42. Gross, O., Poeck, H., Bscheider, M., Dostert, C., Hannesschlager, N., Endres, S., Hartmann, G., Tardivel, A., Schweighoffer, E., Tybulewicz, V., Mocsai, A., Tschopp, J., and Ruland, J. (2009) Syk Kinase Signalling Couples to the Nlrp3 Inflammasome for Anti-Fungal Host Defence. Nature. 459, 433-436.

43. Craven, R. R., Gao, X., Allen, I. C., Gris, D., Bubeck Wardenburg, J., McElvania-Tekippe, E., Ting, J. P., and Duncan, J. A. (2009) Staphylococcus Aureus Alpha-Hemolysin Activates the NLRP3-Inflammasome in Human and Mouse Monocytic Cells. PLoS One. 4, e7446.

44. Warren, S. E., Mao, D. P., Rodriguez, A. E., Miao, E. A., and Aderem, A. (2008) Multiple Nod-Like Receptors Activate Caspase 1 during Listeria Monocytogenes Infection. J. Immunol. 180, 7558-7564.

45. Willingham, S. B., Bergstralh, D. T., O'Connor, W., Morrison, A. C., Taxman, D. J., Duncan, J. A., Barnoy, S., Venkatesan, M. M., Flavell, R. A., Deshmukh, M., Hoffman, H. M., and Ting, J. P. (2007) Microbial Pathogen-Induced Necrotic Cell Death Mediated by the Inflammasome Components CIAS1/cryopyrin/NLRP3 and ASC. Cell. Host Microbe. 2, 147-159.

46. Gurcel, L., Abrami, L., Girardin, S., Tschopp, J., and van der Goot, F. G. (2006) Caspase-1 Activation of Lipid Metabolic Pathways in Response to Bacterial Pore-Forming Toxins Promotes Cell Survival. Cell. 126, 1135-1145.

47. Mishra, B. B., Moura-Alves, P., Sonawane, A., Hacohen, N., Griffiths, G., Moita, L. F., and Anes, E. (2010) Mycobacterium Tuberculosis Protein ESAT-6 is a Potent Activator of the NLRP3/ASC Inflammasome. Cell. Microbiol.

48. Pelegrin, P., and Surprenant, A. (2007) Pannexin-1 Couples to Maitotoxin- and Nigericin-Induced Interleukin-1beta Release through a Dye Uptake-Independent Pathway. J. Biol. Chem. 282, 2386-2394.

49. Dostert, C., Guarda, G., Romero, J. F., Menu, P., Gross, O., Tardivel, A., Suva, M. L., Stehle, J. C., Kopf, M., Stamenkovic, I., Corradin, G., and Tschopp, J. (2009) Malarial Hemozoin is a Nalp3 Inflammasome Activating Danger Signal. PLoS One. 4, e6510.

50. Cruz, C. M., Rinna, A., Forman, H. J., Ventura, A. L., Persechini, P. M., and Ojcius, D. M. (2007) ATP Activates a Reactive Oxygen Species-Dependent Oxidative Stress Response and Secretion of Proinflammatory Cytokines in Macrophages. J. Biol. Chem. 282, 2871-2879.

51. Yamasaki, K., Muto, J., Taylor, K. R., Cogen, A. L., Audish, D., Bertin, J., Grant, E. P., Coyle, A. J., Misaghi, A., Hoffman, H. M., and Gallo, R. L. (2009) NLRP3/cryopyrin is Necessary for Interleukin-1beta (IL-1beta) Release in Response to Hyaluronan, an Endogenous Trigger of Inflammation in Response to Injury. J. Biol. Chem. 284, 12762-12771.

52. Watanabe, H., Gaide, O., Petrilli, V., Martinon, F., Contassot, E., Roques, S., Kummer, J. A., Tschopp, J., and French, L. E. (2007) Activation of the IL-1beta-Processing Inflammasome is Involved in Contact Hypersensitivity. J. Invest. Dermatol. 127, 1956-1963.

53. Feldmeyer, L., Keller, M., Niklaus, G., Hohl, D., Werner, S., and Beer, H. D. (2007) The Inflammasome Mediates UVB-Induced Activation and Secretion of Interleukin-1beta by Keratinocytes. Curr. Biol. 17, 1140-1145.

54. Eisenbarth, S. C., Colegio, O. R., O'Connor, W., Sutterwala, F. S., and Flavell, R. A. (2008) Crucial Role for the Nalp3 Inflammasome in the Immunostimulatory Properties of Aluminium Adjuvants. Nature. 453, 1122-1126.

55. Li, H., Willingham, S. B., Ting, J. P., and Re, F. (2008) Cutting Edge: Inflammasome Activation by Alum and Alum's Adjuvant Effect are Mediated by NLRP3. J. Immunol. 181, 17-21.

56. Netea, M. G., Nold-Petry, C. A., Nold, M. F., Joosten, L. A., Opitz, B., van der Meer, J. H., van de Veerdonk, F. L., Ferwerda, G., Heinhuis, B., Devesa, I., Funk, C. J., Mason, R. J., Kullberg, B. J., Rubartelli, A., van der Meer, J. W., and Dinarello, C. A. (2009) Differential Requirement for the Activation of the Inflammasome for Processing and Release of IL-1beta in Monocytes and Macrophages. Blood. 113, 2324-2335.

57. Guarda, G., Dostert, C., Staehli, F., Cabalzar, K., Castillo, R., Tardivel, A., Schneider, P., and Tschopp, J. (2009) T Cells Dampen Innate Immune Responses through Inhibition of NLRP1 and NLRP3 Inflammasomes. Nature. 460, 269-273.

58. Milhavet, F., Cuisset, L., Hoffman, H. M., Slim, R., El-Shanti, H., Aksentijevich, I., Lesage, S., Waterham, H., Wise, C., Sarrauste de Menthiere, C., and Touitou, I. (2008) The Infevers Autoinflammatory Mutation Online Registry: Update with New Genes and Functions. Hum. Mutat. 29, 803-808.

59. Touitou, I., Lesage, S., McDermott, M., Cuisset, L., Hoffman, H., Dode, C., Shoham, N., Aganna, E., Hugot, J. P., Wise, C., Waterham, H., Pugnere, D., Demaille, J., and Sarrauste de Menthiere, C. (2004) Infevers: An Evolving Mutation Database for Auto-Inflammatory Syndromes. Hum. Mutat. 24, 194-198.

60. Sarrauste de Menthiere, C., Terriere, S., Pugnere, D., Ruiz, M., Demaille, J., and Touitou, I. (2003) INFEVERS: The Registry for FMF and Hereditary Inflammatory Disorders Mutations. Nucleic Acids Res. 31, 282-285.

61. Dode, C., Le Du, N., Cuisset, L., Letourneur, F., Berthelot, J. M., Vaudour, G., Meyrier, A., Watts, R. A., Scott, D. G., Nicholls, A., Granel, B., Frances, C., Garcier, F., Edery, P., Boulinguez, S., Domergues, J. P., Delpech, M., and Grateau, G. (2002) New Mutations of CIAS1 that are Responsible for Muckle-Wells Syndrome and Familial Cold Urticaria: A Novel Mutation Underlies both Syndromes. Am. J. Hum. Genet. 70, 1498-1506.

62. Feldmann, J., Prieur, A. M., Quartier, P., Berquin, P., Certain, S., Cortis, E., Teillac-Hamel, D., Fischer, A., and de Saint Basile, G. (2002) Chronic Infantile Neurological Cutaneous and Articular Syndrome is Caused by Mutations in CIAS1, a Gene Highly Expressed in Polymorphonuclear Cells and Chondrocytes. Am. J. Hum. Genet. 71, 198-203.

63. Hoffman, H. M., Rosengren, S., Boyle, D. L., Cho, J. Y., Nayar, J., Mueller, J. L., Anderson, J. P., Wanderer, A. A., and Firestein, G. S. (2004) Prevention of Cold-Associated Acute Inflammation in Familial Cold Autoinflammatory Syndrome by Interleukin-1 Receptor Antagonist. Lancet. 364, 1779-1785.

64. Goldbach-Mansky, R., Dailey, N. J., Canna, S. W., Gelabert, A., Jones, J., Rubin, B. I., Kim, H. J., Brewer, C., Zalewski, C., Wiggs, E., Hill, S., Turner, M. L., Karp, B. I., Aksentijevich, I., Pucino, F., Penzak, S. R., Haverkamp, M. H., Stein, L., Adams, B. S., Moore, T. L., Fuhlbrigge, R. C., Shaham, B., Jarvis, J. N., O'Neil, K., Vehe, R. K., Beitz, L. O., Gardner, G., Hannan, W. P., Warren, R. W., Horn, W., Cole, J. L., Paul, S. M., Hawkins, P. N., Pham, T. H., Snyder, C., Wesley, R. A., Hoffmann, S. C., Holland, S. M., Butman, J. A., and Kastner, D. L. (2006) Neonatal-Onset Multisystem Inflammatory Disease Responsive to Interleukin-1beta Inhibition. N. Engl. J. Med. 355, 581-592.

65. Villani, A. C., Lemire, M., Fortin, G., Louis, E., Silverberg, M. S., Collette, C., Baba, N., Libioulle, C., Belaiche, J., Bitton, A., Gaudet, D., Cohen, A., Langelier, D., Fortin, P. R., Wither, J. E., Sarfati, M., Rutgeerts, P., Rioux, J. D., Vermeire, S., Hudson, T. J., and Franchimont, D. (2009) Common Variants in the NLRP3 Region Contribute to Crohn's Disease Susceptibility. Nat. Genet. 41, 71-76.

66. Brydges, S. D., Mueller, J. L., McGeough, M. D., Pena, C. A., Misaghi, A., Gandhi, C., Putnam, C. D., Boyle, D. L., Firestein, G. S., Horner, A. A., Soroosh, P., Watford, W. T., O'Shea, J. J., Kastner, D. L., and Hoffman, H. M. (2009) Inflammasome-Mediated Disease Animal Models Reveal Roles for Innate but Not Adaptive Immunity. Immunity. 30, 875-887.

67. Meng, G., Zhang, F., Fuss, I., Kitani, A., and Strober, W. (2009) A Mutation in the Nlrp3 Gene Causing Inflammasome Hyperactivation Potentiates Th17 Cell-Dominant Immune Responses. Immunity. 30, 860-874.