Phenotypic Mutation 'zuckerkuss' (pdf version)
List |< first << previous [record 20 of 74] next >> last >|
Allelezuckerkuss
Mutation Type critical splice donor site (1 bp from exon)
Chromosome15
Coordinate11,025,935 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) blanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
Chromosomal Location 11,000,721-11,029,233 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000022851 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:MFS_1 36 364 1.3e-9 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI
All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 nonsense
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 missense probably benign 0.05
galak UTSW 15 11012667 nonsense
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense probably damaging 0.96
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 0.96
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.00
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

none

Last Updated 2018-08-01 4:39 PM by Diantha La Vine
Record Created 2010-01-18 12:00 AM
Record Posted 2010-01-26
Phenotypic Description

The zuckerkuss mutation was induced by ENU mutagenesis on the C57BL/6J (black) background and was discovered in G3 animals. The mutant mice exhibit a “dirty white” coat color and red eyes (Figure 1).  

Nature of Mutation
The Slc45a2 gene was directly sequenced and a mutation corresponding to a G to T transversion in the donor splice site of intron 6 was found (position 25214 in Genbank genomic region NC_000081 for linear genomic DNA sequence of Slc45a2). Slc45a2 contains 7 exons encoding 530 translated amino acids. The effect of the mutation at the cDNA and protein level has not been determined. One possibility, shown below, is that aberrant splicing results in skipping of exon 6, and a frameshift that creates a premature stop codon at the beginning of exon 7 with truncation occurring after amino acid 385.
 

       <--exon 5      <--exon 6 intron 6-->      exon 7-->
22736 GTTTATTCAT......GAGAAAGAG GTGGGTGACAA......AAGGGGCAG 27003
383   -V--Y--S--......-E--K--E-                  *         385
       correct         deleted                   aberrant

 
The donor splice site of intron 6, which is destroyed by the zuckerkuss mutation, is indicated in blue; the mutated nucleotide is indicated in red.
Protein Prediction
Figure 2. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The zuckerkuss mutation causes premature truncation that occurs near the end of the eighth transmembrane domain of the SLC45A2 protein. This image is interactive. Click on the mutations for more specific information. 
The zuckerkuss mutation causes premature truncation that occurs near the end of the eighth transmembrane domain of the SLC45A2 protein. It is unknown whether normal levels of the altered protein exist in zuckerkuss mice or whether this protein is localized appropriately.
 
Please see the record for cardigan for more information about Slc45a2.
Putative Mechanism

The premature truncation of SLC45A2 caused by the zuckerkuss mutation is likely to result in a protein that is unable to localize appropriately to the membrane. Zuckerkuss mice have a severe hypopigmentation phenotype that resembles other alleles of Slc45a2 resulting in nonfunctional protein. These include alleles that cause premature truncation of SLC45A2 such as cardigan and underwhite (1-3). Similarly, humans with SLC45A2 mutations causing protein truncation in the seventh or ninth transmembrane domains have very little pigmentation in their skin and eyes (4).

Primers Primers cannot be located by automatic search.
Genotyping
Zuckerkuss genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
Zucker(F): 5’- AGAGTCAGCAAGGCAACTTCATGC -3’
Zucker(R): 5’- GGTAAGGGTTAAGTCACCGTTCCAG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Zucker_seq(F): 5'- TGCAAAGGATTTAAAACTGATCCCC -3'
Zucker_seq(R): 5’- CCTTAGATCAGGGGTAGCATCAC -3’
 
The following sequence of 838 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 15, bases 10,955,248 to 10,956,085; Genbank genomic region: NC_000081) is amplified:
 
  1 agagtcagca aggcaacttc atgctgtctt ttatgcaaag gatttaaaac tgatccccaa
 61 agccagctgt ttctggcaca cagataagga agtattttgt ttctgactca gtatcaaagg
121 aagtcgtcta aaaaggaaag tgcatcttca aaagaaagga ttatctgaag ttattagata
181 ttgtgcggca ctgccagctg taattttccc ccctttattc tctctacaga ctttcagaaa
241 gctatggtct cctacattgg attaaaaggc ctttatttca tgggatattt gctctttggc
301 ctgggaacag gattcatagg actctttcca aatgtgtact ctactctggt cctctgttct
361 atgtttggtg taatgtccag cacattgtac actgtgccct ttaacctcat tgctgagtac
421 caccgtgaag aggagaaaga ggtgggtgac aaagggaatt tacctcaagg ataagggaag
481 gaaggaagga aggaaggaag gcagaaggat gcttaaacaa gtataaccat gcaaacatga
541 ctacaaagct aggagagttc tctctttgct gtgaatccct atgcaccttt tgaattttag
601 gacaatgata gtgaccccaa atatctgatt aaagtaggta ggctcactga tgatgagaaa
661 tgagtccttg atcagactga gacaaagagg ccctatgtct tttgcaacca ctctaaggag
721 ctttcaacat cgcagcattt ctagatgccc acagtgatgc tacccctgat ctaaggtaca
781 gagaagcatg gtggcatttc ttgcggttac agtctggaac ggtgacttaa cccttacc
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is indicated in red.

 

References
Science Writers Nora G. Smart
Illustrators Nora G. Smart, Diantha La Vine
AuthorsChristina Neppl, Bruce Beutler
List |< first << previous [record 20 of 74] next >> last >|
Edit History
2011-08-25 12:05 PM (current)
2011-01-07 9:09 AM
2010-07-07 2:47 PM
2010-07-07 2:47 PM
2010-02-25 2:51 PM