Allele | busy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | nonsense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 19 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 40,952,391 bp (GRCm38) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Blnk | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | B cell linker | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 40,928,927-40,994,535 bp (-) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012] PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Tyrosine changed to Stop codon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9QUN3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure | Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000057844 Gene: ENSMUSG00000061132 AA Change: Y189*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000112473 Gene: ENSMUSG00000061132 AA Change: Y189*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.142) ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | CE: no linkage results | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(34) : Targeted, knock-out(4) Gene trapped(29) Chemically induced(1) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 032882-MU | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-10-25 5:21 PM by Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2010-01-29 4:55 PM by Carrie N. Arnold | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2010-05-06 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Mutations in This Stock |
Stock #: F6893 Run Code: SLD00203 Coding Region Coverage: 1x: 88.7% 3x: 74.0% Validation Efficiency: 165/188
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The busy mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses. The index mouse mounted no detectable T-independent immunoglobin M (IgM) response to haptenated ficoll, and a sub-optimal T-dependent IgG response to model antigens encoded by a recombinant suicide vector based on the Semliki Forest Virus (rSFV). Flow cytometry analysis of blood from this mouse revealed a severe reduction in cluster of differentiation (CD) 19+ cells indicating a lack of peripheral B cells, and significantly increased frequencies of blood CD4+ and CD8+ T cells. A male sibling of the busy mouse had normal frequencies of peripheral blood lymphocytes and a normal T-dependent IgG response, but a low T-independent IgM response. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
1027 GATAACGATGAAAACTATATCCATCCCAGAGAA
184 -D--N--D--E--N--Y--I--H--P--R--E-
The mutated nucleotide is indicated in red lettering, and converts a tyrosine at amino acid 189 of the encoded protein to a stop codon.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction | The Blnk gene encodes a 457 amino acid protein known as B cell linker (BLNK), Src homology 2 (SH2) domain-containing leukocyte protein of 65 kDa (SLP-65), or B cell adaptor containing a SH2 domain (BASH) (1-3), and functions downstream of the pre-B cell receptor (pre-BCR) and the B cell antigen receptor (BCR; see Background). BLNK belongs to the SLP-76 family of adaptor proteins that includes SLP-76, BLNK and cytokine-dependent hematopoietic cell linker (CLNK) [reviewed by (4;5)]. Mouse BLNK shares 85% identity with the 456 amino acid human BLNK, but mice lack the alternatively spliced product found in humans known as BLNK-S and missing residues 203-225 (1).
The BLNK protein is composed of a basic region comprising the first 45 amino acids, followed by an acidic region at residues 46-110, a central proline-rich region at amino acids 111-345, and a C-terminal SH2 domain at residues 346-454 (1-3;6)(Figure 3). The basic region is predicted to contain a leucine zipper (LZ) with leucine or isoleucine seven-residue (abcdefg) repeats forming a potential amphipathic α-helix (6). Positions ‘a’ and ‘d’ in each repeat are typically a hydrophobic residue (mainly leucine or isoleucine) and positions ‘e’ and ‘g’ usually are charged amino acids (7). The BLNK LZ is necessary for subcellular localization (see Expression/Localization) and function of the protein. Mutation of residues Leu 18 and Ile 25 abrogated both of these functions (6). The BLNK N-terminal domain has been shown to bind to the chicken proteins BASH N terminus associated protein 1(BNAS1) and BNAS2. Both of these proteins contain LZ domains that likely interact with the BLNK LZ and are either transmembrane (BNAS2) or membrane-associated (BNAS1) proteins localized to the endoplasmic reticulum (ER) (8;9).
SH2 domains consist of about 100 amino acids and can function as regulatory modules of intracellular signaling cascades by interacting with high affinity to phosphotyrosine-containing target peptides in a sequence-specific manner (10). The acidic and proline domains of BLNK contain five canonical YXXP tyrosine phosphorylation motifs surrounding Tyr 72, Tyr 84, Tyr 96, Tyr 178, and Tyr 189. Phosphorylation of these tyrosines by the spleen tyrosine kinase (Syk) induces associations with SH2 domain-containing molecules such as Vav1-3, which are guanine nucleotide exchange factors (GEFs) for the Rho family of GTP binding proteins, Nck (non-catalytic region of tyrosine kinase adaptor protein), Bruton’s tyrosine kinase (Btk), and phospholipase C γ2 (PLC-γ2; see the record for queen) (1;2;11-15). Tyr 84, 178 and 189 of BLNK bind PLC-γ2, Tyr 96 binds to Btk, and Tyr 72 binds to both Vav and Nck (2;14). The proline-rich region of BLNK binds to the SH3 domains of growth factor receptor-bound 2 (Grb2) adaptor protein using an atypical SH3 domain-binding motif (PxxxRxxKP) (1;2;16;17). This motif is missing in the short form of the human protein, which is unable to bind to Grb2 (17). The coordinate binding of these factors to BLNK promotes interactions amongst them and is necessary for the full signaling response downstream of the pre-BCR and BCR (14;15). Recently, phosphorylated Tyr 96 was also found to be critical for binding to and inhibiting the SH2 domain-containing tyrosine kinase Janus kinase 3 (JAK3), while the adjacent tyrosines 84 and 119 had minor roles (18).
In addition to being a Syk substrate, BLNK binds to an autophosphorylated tyrosine located near the C-terminus of Syk through its SH2 domain, an association that is required for prolonged Syk activation (19). The SH2 domain of BLNK also associates with the phosphorylated, non-ITAM (immunoreceptortyrosine-based activation motif) Tyr 204 of Igα, a signal-transducing component of the pre-BCR and BCR (20;21), and the hematopoietic progenitor kinase (HPK)1 (22;23). Like other SH2 domains, the SH2 domain of BLNK contains a central hydrophobic anti-parallel β-sheet, flanked by 2 short α-helices (PDB 2EO6)(Figure 4). The loop between strands 2 and 3 in the SH2 domain provides many of the binding interactions with the phosphate group of phosphopeptide ligands, and is known as the phosphate binding loop. The phosphorylated ligand binds perpendicular to the β-sheet and typically interacts with the phosphate binding loop and a hydrophobic binding pocket that interacts with the phosphorylated tyrosine motif (10).
Chicken BLNK is phosphorylated on multiple serine and threonine residues. Some of these residues are phosphorylated in resting cells, while others become phosphorylated upon BCR activation. The pattern of BLNK phosphorylation over time is highly complex and dynamic. One of these residues Ser 170 (151 in mouse), was found to be necessary for the activation of the mitogen activated protein (MAP) kinases p38 and c-Jun N-terminal kinase (JNK), which are important in activating the activator protein 1 (AP-1) transcription factor composed of c-Jun and ATF2 (27).
The busy mutation causes a truncation of the BLNK protein at one of the PLC-γ2 binding tyrosines prior to the proline-rich region and the SH2 domain. It is unknown if the premature truncation results in nonsense-mediated protein degradation.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Human BLNK mRNA is predominantly expressed in the spleen, although expression is also detected in liver, kidney, and pancreas. Both human isoforms are expressed at equal levels (1). Expression data from SymAtlas shows that BLNK mRNA is also highly expressed in human dendritic cells (DCs). In the mouse, Blnk mRNA is expressed in the spleen and weakly in the thymus, while no expression was detected in liver, testis, or brain (2). Expression was also seen in multiple human and mouse B cell lines including those representing different developmental stages from the pre-B to the mature B cell stage. Blnk mRNA or protein was not detected in T cells or other hematopoietic or nonhematopoietic-derived cell lines (1;2). B cell expression was confirmed by FACS analysis. Analysisof murine bone marrow-derived cells using FACS analysis showed that the highest BLNK expression occurred during early B cell development, with progressively lower expression occurring as the cells matured (28). BLNK is also expressed in murine macrophages (29).
BLNK is mainly cytoplasmic, but some protein is constitutively localized to the membrane via the leucine zipper domain (6). BLNK may also be recruited to the membrane by direct binding of its SH2 domain to the Igα subunit of the BCR (20;21). Engagement of the pre-BCR or BCR recruits BLNK into lipid rafts, specialized membrane micro-domains that allow the clustering of molecules necessary for signaling (15;30).
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background | The SLP-76 family of adaptor proteins is composed of proteins critical for integrating numerous signaling cascades downstream of ITAM-bearing receptors and integrins in hematopoietic cells. BLNK was first identified and cloned based upon its phosphorylation downstream of BCR stimulation (1-3;31). Furthermore, Blnk knockout mice display a block specifically in B cell development and defects in BCR signaling, suggesting a B cell specific role (28;32-34). In T cells, the functions performed by BLNK appear to be split between LAT (linker for activation of T cells) and SLP-76 (5). Indeed, BLNK-deficient B cells can be rescued by coexpressing SLP-76 and LAT (35). Similar results are observed when the third member of the SLP-76 family of adaptors, CLNK, is coexpressed with LAT in BLNK-deficient cells (36). CLNK is expressed in activated T cells, NK cells, and mast cells, but is dispensable for normal immune function (37).
Naïve B cells are generally divided into three subsets, B-1 B cells, follicular B cells (conventional B-2 cells), and marginal zone (MZ) B cells. B cell development first begins in the fetal liver, but conventional B-2 cells and MZ B cells are produced after birth and replaced in the bone marrow throughout life. The origins of B-1 cells are controversial, but they may derive from progenitors present in the fetal liver and neonatal bone marrow [reviewed by (49)]. While conventional B cells mediate secondary immune responses and secrete immunologlobin G (IgG), B-1 cells predominantly secrete IgM, IgG3 and IgA (50). The development of B cells in the bone marrow is characterized by the differential expression of marker proteins such as CD45 (B220) (see the record for belittle) and CD43, and sequential recombination of immunoglobulin gene loci [reviewed in (38)]. In addition, the development of early B lymphopoiesis is regulated by a network of key transcription factors that include PU.1 (an ets-family member), Ikaros, Bcl11a (a zinc finger transcription factor), E2A (a helix-loop- helix protein), EBF (early B cell factor) and the paired box protein, Pax5 (51), which has been shown to directly regulate Blnk transcription (52). B cell development begins when lymphoid progenitor cells or prepro-B cells receive signals, such as interleukin 7 (IL-7), from bone marrow stromal cells. During the pro-B stage, these cells rearrange their immunoglobulin heavy (IgH) chains in a process known as VDJ recombination mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive). The diversity (D) and joining (J) gene segments are first recombined together, followed by the variable (V) segment. Although B lineage cells can undergo VDJ rearrangement at both IgH loci, only one of the IgH alleles is expressed by the B cell, a process known as allelic exclusion. Successful VDJ recombination gives rise to the Igμ chain, two of which combine with the surrogate light chains (SLCs), λ-5 and Vpre5, and the signaling subunits Igα and Igβ to complete the pre-BCR complex. Large pre-B cells expressing the pre-BCR are competent for pre-BCR signaling, which initiates proliferation, further differentiation, and eventually downregulates expression of the pre-BCR. Subsequently, rearrangement of the immunologlobin light (IgL) chain by the RAG1-RAG2 complex occurs to form the BCR (or surface IgM) characteristic of immature B cells. Receptor editing through successive rearrangements of Ig genes at this stage is a major mechanism for negatively selecting self-reactive B cells. Transition of the cells into fully mature B cells requires BCR signaling and is associated with migration from the bone marrow to the spleen and lymph nodes (38).
Blocks in B cell development are observed in several mouse mutant models, including animals that are deficient for factors necessary for VDJ recombination, components of the pre-BCR complex, and the pre-BCR signal transduction machinery. While mutations in Pax5, Rag1, Rag2, Igμ, Igα, and Igβ lead to an absolute block in B cell development during the pro-B stage (38;51;53;54), mutations in the SLC and pre-BCR signal transduction components, including Btk, Syk, BLNK, the p85 subunit of PI3K and PLC-γ2, result in an incomplete block at the pre-B cell transition (38;55;56). As the pre-BCR signal transduction molecules are also needed for BCR signaling, mice deficient in these proteins display an additional partial or complete block (in the case of Syk-deficient mice) at the immature B cell stage [reviewed by (38;57)]. The partial developmental blocks observed in BLNK-deficient mice suggest that BLNK is dispensable for some aspects of BCR signaling. Indeed, studies of BLNK-deficient primary B cells have shown partially preserved signaling downstream of the BCR including reduced, but not absent, levels of phosphorylated PLC-γ2 and Ca2+ flux, and the retention of some MAPK signaling (28;32;58). In addition, BLNK is not needed to establish allelic exclusion in B cells (59), but is necessary for light chain rearrangement and receptor editing (60). One explanation of these phenotypes includes possible partial redundancy with other adaptors or molecules during pre-BCR and BCR signaling. BLNK deficiency, combined with deficiencies in the adaptor molecule LAT, the BCR costimulatory molecule CD19, Btk, or PLC-γ2, result in much more severe blocks in B cell development than in the single mutants alone (61-63). Although pre-BCR signaling is necessary for pre-B cell proliferation, it is also necessary for the eventual differentiation of these cells. Because of this, many of the mouse models with blocks at the pre-B cell transition display high incidences of pre-B cell lymphoma. 5-15% of Blnk knockout mice develop pre-B cell leukemia and BLNK-deficient pre-B cells display an increased proliferative capacity that is IL-7 and pre-BCR dependent (61;64). IL-7 signaling activates the JAK3/STAT5 (signal transducer and activator of transcription 5) pathway, which is inhibited by BLNK (18).
As in mice, humans with mutations in the BLNK gene display a developmental block during B cell development (65;66). This block appears to be more complete in humans with patients displaying normal numbers of pro-B cells, but no pre-Bcells or mature B cells (65), although a very small number of peripheral B cells with an immature phenotype have been reported for some patients (66). In humans, mutations in BTK, BLNK, λ-5, Igμ, Igα, and Igβ cause agammaglobulinemia and severe immunodeficiency (OMIM #300755, #601495) [reviewed by (66)]. Many leukemias are also caused by mutations in these genes as well (38), and a subset of childhood pre-B-cell acute lymphoblastic leukaemia (pre-B-ALL) cells lack expression of BLNK, suggesting BLNK may play an important role as a tumor suppressor in this disease (67;68). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | B cell responses are classified as T-dependent (T-D) or T-independent (T-I) based on their requirement for T cell help in antibody production. T cell-dependent antigens are processed and presented to helper T cells via the MHC class II molecules, and induce a long-lasting immune response that includes the formation of memory B and T cells, and the production of high-affinity antibodies of multiple isotypes. T-I antigens are divided into type I and type II. The former are mitogenic stimuli such as lipopolysaccharide (LPS), CpG DNA, or poly-IC (a double-stranded RNA mimetic) that elicit polyclonal B cell activation via Toll-like receptors (TLRs), while the latter are polysaccharides that cannot be processed and presented by MHC molecules. These antigens are often expressed on the surface of pathogens in an organized, highly repetitive form that can activate specific B cells by cross-linking of antigen receptors. The formation of antigen receptor clusters can recruit and activate multiple Btk molecules, resulting in long-term mobilization of intracellular ionized Ca2+, gene transcription and B cell activation and proliferation. T-I type II antigens elicit robust antigen-specific primary and memory responses. The T-D B cell response is mediated by conventional B-2 cells, while T-I B cell responses are mediated by peritoneal B-1 and MZ B cells [reviewed by (69;70)].
BLNK-deficient animals are reported to have a severe defect in their primary antibody response with severely reduced levels of serum IgM and IgG3, but a fairly normal secondary response with only mildly affected levels of IgG1 and IgG2 (28;32-34). Furthermore, these mice are unable to mount T-I type II responses, but can respond to T-dependent antigens (32;34). These results are likely due to the complete absence of B-1 cells reported in these animals, while the presence of some peripheral, albeit immature, B-2 cells allows the development of a T-D response. Further analysis of the T-D response in Blnk knockout mice revealed a defect in the primary antibody response with suboptimal antibody formation, but normal affinity maturation and memory B cell generation (71). These findings are consistent with the phenotypes observed in busy mice, which completely lack a T-I response but display a suboptimal T-D response. B cell proliferation and the generation of the T-I, but not the T-D antibody response, depends upon the activation of many of the BCR signaling molecules as mice deficient in PLC-γ2, Btk, the p85 subunit of PI3K, and PKCβ all displayed a defective T-I, but fairly normal T-D response (57). In addition, splenic B cells from mice carrying a targeted mutation of Igα, in which the BLNK-binding tyrosine Tyr204 has been mutated, display a specific defect in response to T-I antigens, but have normal T-D responses (72). It is unclear if BLNK is necessary for B cell proliferation in response to T-I type I stimuli, or plays a role in upregulating MHC class II molecules as both defective and normal responses have been reported for BLNK-deficient B cells (28;32-34;58). A diminished capacity to upregulate MHC class II molecules may partially explain the suboptimal T-D response seen in busy and other BLNK-deficient mouse models.
The busy mutation causes a premature truncation of the BLNK protein. It is likely that this protein is non-functional as it is missing most of the proline-rich region and the SH2 domain, which have been shown to be critical in transducing BLNK-dependent signals downstream of the BCR (17;19-21). However, the truncated protein retains the N-terminal LZ domain important in BLNK localization, as well as most of the tyrosines necessary for binding to many of the molecules involved in BCR signaling, raising the possibility that the busy allele is hypomorphic rather than functionally null.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Busy genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
Primers
Busy (F): 5’- TAAGGGACTCCAGCAGCCATGAAC -3’
Busy (R): 5’- ACCATTCTGAGTGAAGGCAGCG -3’
PCR program
1) 95°C 2:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C 8
Primers for sequencing
Busy_seq(F): 5'- GCCATGAACTTAGCATTCAAGG -3'
Busy_seq(R): 5’- AAGCAGGTGCTTCCCTAGTC -3’
The following sequence of 547 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 19, bases 41,026,604 to 41,027,150) is amplified:
taagggactc cagcagccat gaacttagca ttcaaggggc agagtctggt aggcaagccc
ctgtatatac aatggataac taagtgccaa aaggtacccc attgtaagca attttacagt
gtgtgaatta tagcccatta aagcttttat agacaaaaat atctctttct cccacaatta
actatgaatg tatagcaagc gttctcttca cctctatatt tcttttaggc tgattatgtg
gtccctgtgg aagataacga tgaaaactat atccatccca gagaaagcag cccgccgcct
gctgagaagg gtaagctttg gagtttgggg tgcttgaaag cttccagcag ttgcctggca
ccaggctgct cagccaataa gcactgggga gctcaggtgg ggcaagggcc tctcctctgt
agccacgccc cctcgactag ggaagcacct gcttcagagc ctttctcctc cttccatgtt
cacgggttta ttcccaggtt ataaaagcac tgggctatcg tcctccgctg ccttcactca
gaatggt
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
7. Lupas, A. (1996) Coiled Coils: New Structures and New Functions. Trends Biochem. Sci. 21, 375-382.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Nora G. Smart | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Carrie N. Arnold and Elaine Pirie |