Phenotypic Mutation 'thunder' (pdf version)
List [record 98 of 0]
Allelethunder
Mutation Type missense
Chromosome17
Coordinate80,053,571 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Hnrnpll
Gene Name heterogeneous nuclear ribonucleoprotein L-like
Synonym(s) 2510028H02Rik, Hnrpll, 2810036L13Rik
Chromosomal Location 80,029,487-80,062,334 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_144802; MGI: 1919942

Mapped Yes 
Amino Acid Change Valine changed to Aspartic acid
Institutional SourceAustralian Phenomics Network
Gene Model not available
PDB Structure
Solution structure of RRM domain in protein BAB28521 [SOLUTION NMR]
Solution structure of RNA binding domain 2 in Heterogeneous nuclear ribonucleoprotein L-like [SOLUTION NMR]
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: V136D

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000061331)
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095
AA Change: V136D

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000184297)
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: V136D

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000184635)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells - decreased
FACS CD8+ T cells - decreased
immune system
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpll APN 17 80038740 missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80044504 missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80050713 missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80061991 start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80034098 missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80061832 missense unknown
R1599:Hnrnpll UTSW 17 80053625 missense unknown
R1700:Hnrnpll UTSW 17 80034105 missense probably benign 0.18
R1838:Hnrnpll UTSW 17 80038623 missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80035329 critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80044518 missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80035377 missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80049805 critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80050862 nonsense probably null
R5175:Hnrnpll UTSW 17 80034070 missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80038678 missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80038622 missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80034191 missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80049876 missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80049874 missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80034057 missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

Australian PhenomeBank: 78

Last Updated 2016-05-13 3:09 PM by Bruce Beutler
Record Created 2010-02-01 5:27 PM by Eva Marie Y. Moresco
Record Posted 2010-02-02
Phenotypic Description
The thunder (Th cells under normal) phenotype was identified in a flow cytometry screen of blood from ENU-mutagenized mice for mutations affecting the circulating proportions of memory and naïve T cells (1). Homozygous thunder mice displayed an increased percentage of CD4+ and CD8+ cells expressing high levels of CD44 (a marker of activated and memory T cells), which resulted from a reduction in the absolute number of CD44lo cells in the peripheral blood, spleen, and lymph node (Figure 1A, D). However, thymic T cell development, numbers of CD4+ and CD8+ single positive (SP) thymocytes, and numbers of peripheral CD4+ and CD8+ T cells were all normal in homozygous thunder mice relative to wild type mice (Figure 1C). Thunder heterozygotes displayed an intermediate defect in all aspects of the phenotype.
 
The defect in the number of naïve T cells is cell-autonomous, as demonstrated by bone marrow transplantation of mixed wild type and thunder bone marrow into irradiated wild type mice. Compared to control cells, mutant naïve and memory T cells failed to accumulate in the periphery of reconstituted animals. In contrast to thunder homozygotes in which all T cells bear the mutation, in mixed chimeras there was no increase in the percentage of CD44hi T cells within the peripheral T cell subset bearing the mutation. This finding suggests that homeostatic proliferation of CD44hi T cells compensates for peripheral lymphopenia in thunder homozygotes, whereas in mixed chimeras compensation occurs through replacement by wild type T cells.
 
Adoptive transfer of a mixture of CFSE-labeled wild type and thunder thymocytes into Rag1-/- or irradiated mice lacking peripheral T cells demonstrated a failure of mutant cells to repopulate recipient mice, although they proliferated normally. Homozygous thunder T cells also proliferated normally when stimulated with anti-CD3/CD28 antibodies, and differentiated into Th1 or Th17 effector cell subsets. Upon challenge with influenza virus, thunder mice were capable of generating large populations of nucleoprotein-specific CD8+ T cells. Together, these data indicate that the reduction in naïve T cells observed in thunder homozygotes results from a failure in persistence but not in proliferation of T cells.
 
Staining for CD45 (encoded by Ptprc, mutated in belittle and lochy), a transmembrane tyrosine phosphatase expressed as several isoforms due to alternative splicing, revealed a high level of expression of the RA, RB, and RC isoforms (corresponding to expression of either exon 4, 5, or 6, respectively; see Background) on homozygous thunder splenic CD4+ T cells relative to wild type cells (Figure 1B). Homozygous thunder splenic CD8+ T cells also expressed high levels of CD45RA and RC, but similar levels of CD45RB compared to wild type cells. Overall, levels of CD45RA, CD45RB, and CD45RC on thymic and peripheral T cell populations were 10-100 times higher in thunder homozygotes than in wild type mice, and were comparable to the amounts on B cells that do not silence these exons. However, total CD45 expression on CD4+ and CD8+ T cells, detected using a pan-CD45-specific antibody, was normal.  B cell expression of CD45 isoforms was also comparable in homozygous thunder and wild type mice. When mRNA was analyzed by RT-PCR for the presence of exons 4, 5, and 6, homozygous thunder thymocytes were found to contain a high proportion of Ptprc mRNA containing exons 4, 5, and 6, while wild type thymocytes predominantly carried Ptprc mRNA lacking exons 4, 5, and 6 or containing only exon 5. In heterozygous thunder mice, the silencing defect was intermediate, and correlated with the number of exonic splicing silencer (ESS) motifs (2-4) present in the exon. Thus, the effect of the thunder mutation on alternative splicing is gene-dosage sensitive.
 
Thunder homozygotes are born at the expected Mendelian frequency, and are indistinguishable from wild type littermates in appearance and behavior.
Nature of Mutation
The thunder T cell phenotypes (failure to silence CD45 variable exons and naïve T cell deficiency) were mapped to Chromosome 17. A single mutation within the critical region was identified, a T to A transversion at position 749 of the Hnrpll transcript, in exon 2 of 13 total exons.
733 GGGCTCTGTGAATCTGTTGTGGAAGCTGACCTT
131 -G--L--C--E--S--V--V--E--A--D--L-
The mutated nucleotide is indicated in red lettering, and results in a valine to aspartic acid substitution at amino acid 136 of the hnRNPLL protein.
Protein Prediction
Transcripts produced in the nucleus by RNA polymerase II are termed precursor (pre-mRNA) or heterogeneous nuclear RNA (hnRNA), referring to their size heterogeneity and cellular localization. hnRNAs are associated with proteins from the moment they exit the transcription machinery, and the term heterogeneous nuclear ribonucleoprotein (hnRNP) originally referred to this group of proteins (not including proteins of the small nuclear ribonucleoprotein complexes, snRNPs; see Background), which could be cosedimented with hnRNA through sucrose density gradients (5;6). Later, hnRNPs were captured by UV-induced RNA-protein crosslinking in cells, and purified using monoclonal antibodies (7-9). Currently, the mammalian hnRNP family consists of a group of 24 proteins that stably associate with hnRNA. They are among the most abundant proteins in the nucleus, present in amounts nearly equal to those of the histones. Although all bind to RNA, the structures of hnRNPs are quite diverse, reflecting differences in binding preference for specific RNA sequences and protein partners (10;11).
 
All hnRNPs contain RNA binding domains as their defining feature (Figure 2). Several types of RNA binding domain exist, including the most common RNA recognition motif, RRM (also known as consensus RNA-binding domain, CS-RBD; ribonucleoprotein motif, RNP), as well as the quasi(q)RRM, RGG motif, and K homology (KH) motif (6). The hnRNP L-like (hnRNPLL) protein contains either three or four RRMs, depending on the amino acid sequence analysis program used (12;13). hnRNPLL may be grouped with hnRNPI (polypyrimidine tract binding protein, PTB) and hnRNPL, each of which contain four RRMs, and share significant similarity across the length of the protein. hnRNPLL is 62% similar and 50% identical to hnRNPL, and 39% similar and 23% identical to PTB.
 
The RRM is an approximately 90 amino acid domain containing two short, conserved RNA-binding sequences (14;15). The RNP consensus sequence or RNP1 consists of eight residues that are mainly aromatic and positively charged, and follows the pattern [K/R]-G-[F/Y]-[G/A]-[F/Y]-[V/I/L]-X-[F/Y].  RNP2 is a sequence of six amino acids near the N-terminus of the domain, [I/V/L]-[F/Y]-[I/V/L]-X-N-L. The three dimensional structures of many isolated RRMs have been determined, including those of the first (by NMR) (1) and second RRMs (PDB ID 2E5I; no published journal reference) found in hnRNPLL (Figure 3). Like other RRMs, the two solved hnRNPLL RRMs fold into an αβ sandwich structure with a β1-α1-β2-β3-α2-β4 topology. The β strands form an antiparallel β-sheet, which forms the primary contacts with RNA, and two α-helices pack against it. The RNP1 and RNP2 motifs are located in the central strands (β3 and β1, respectively) of the β-sheet. The classic RRM-nucleic acid binding mode, deduced from structural analysis of other published complexes, involves three key aromatic residues within RNP1 and RNP2 (14;15). Two nucleotide bases stack on the aromatic rings of two of these residues, with the third aromatic ring inserted between the sugar rings of the nucleotide backbone. In hnRNPLL (and PTB and hnRNPL), however, none of these three residues are conserved, suggesting a different mechanism of RNA binding.  Notably, other less conserved residues apart from the amino acids at the surface of the β-sheet can contribute or even completely mediate RNA binding. In particular, the loops connecting β-strands and α-helices can be crucial for nucleic acid recognition. Loops β1/α1, β2/β3, and α2/β4 have been shown to participate in RNA binding in several RRM-containing proteins, including RBMY (16), Fox-1 (17), and hnRNP F (18).  Some RRMs have been shown to mediate interactions with proteins, such as those of PTB and p14, a component of the human U2 snRNP (19;20).
 
In general, RRMs are found in multiple copies within a protein, as in hnRNPLL. Such a configuration may allow continuous recognition of a long nucleotide sequence, increasing binding affinity (14). hnRNPs also often contain one or more protein-protein interaction domains, such as proline-rich, glycine-rich, and acidic domains (5).  hnRNPLL has several predicted protein interaction motifs: a PTB interaction site, SH2 domains, WW domain, coiled coil region, and PDZ domain (13). The functional significance of these predicted features is unknown.
 
The thunder mutation in valine136 is located within loop β1/α1, connecting strand β1 to helix α1, in the first predicted RRM of hnRNPLL. Valine136 is conserved in puffer fish, chicken, and several mammalian species, and in mouse hnRNPL and PTB (1).
Expression/Localization
Human HNRPLL is alternatively spliced to produce at least 5 mature transcripts, which variably include exons 1, 5, 7, and 14, or portions thereof (13). These transcripts are differentially expressed in various tissues, as measured by RT-PCR. Two are reportedly specific for bone marrow stromal cells, and one for lymphoid tissue (AL512692 from NCBI NR database) (13). The GNF Symatlas indicates highest Hnrpll expression in thymus and testis. RT-PCR measurements also showed Hnrpll expression in T cells, with 3-fold increased expression in memory versus naïve T cells (1). B cells express much less Hnrpll mRNA than T cells (1). GEO-deposited microarray data show that Hnrpll mRNA is induced 4-fold by TCR stimulation through PKC-dependent signaling (21), and is expressed at higher levels in Foxp3+CD25+ regulatory T cells relative to CD4+CD25- T cells (22).
 
The subcellular localization of hnRNPLL has not been reported. When visualized with immunofluorescent microscopy, other hnRNPs typically show general nucleoplasmic localization with little or no staining in the nucleoli or in the cytoplasm (5). Most of the nuclear signal is thought to represent hnRNPs bound to nascent RNA polymerase II transcripts, and the rest hnRNPs bound to transcripts being processed and mature transcripts awaiting transport to the cytoplasm (5). hnRNPs are not usually found in nuclear “speckles”, interchromatin granules where snRNPs are concentrated (23). In addition to diffuse nucleoplasmic localization, hnRNPL and PTB are also specifically observed in discrete non-nucleolar structures of unknown function (12;24).
Background
The removal of introns from pre-mRNAs to produce functional mRNAs occurs in a process known as splicing. Alternative splicing is the process by which exons are differentially incorporated (and introns are removed) to produce two or more distinct mature mRNAs from a single pre-mRNA, and provides one mechanism for generating protein diversity in complex organisms (25). In a genome-wide microarray study monitoring splicing at every exon-exon junction, more than 74% of human multi-exon genes were alternatively spliced (26).
 
Cells control constitutive and alternative splicing by regulating the assembly of the pre-mRNA splicing machinery, a giant macromolecular complex (containing 100-200 proteins and approximately 3 megadaltons in size) collectively known as the spliceosome (27).  The U1, U2, U4/U6, and U5 small nuclear ribonucleoprotein complexes (snRNPs), named for the uridine-rich small nuclear RNAs (U snRNAs) they contain, are the key subunits of the spliceosome, associating/dissociating with the pre-mRNA substrate at discrete steps of the spliceosome cycle to mediate intron removal and exon joining. (In addition to the U2-dependent major spliceosome, metazoan cells contain a U12-dependent minor spliceosome responsible for removal of approximately 0.25% of all introns (28).) Intron excision and joining of flanking exons is directed by four required cis-acting RNA elements within the intron that are recognized by base pairing with the U snRNAs (29). The 5’ splice site (donor site) marks the exon/intron junction at the 5’ end of the intron, and consists of nine bases including an invariant GU dinucleotide. Near the 3’ end of the intron are the three other elements: a branch point adenosine (A) residue, polypyrimidine tract, and the 3’ splice site (acceptor site) consisting of about 15 bases including an invariant AG dinucleotide at the intron/exon junction. The spliceosome catalyzes the two transesterification steps of the splicing reaction (Figure 4) (25). In the first step, the 2’-OH group of the branch point A attacks the phosphate at the 5’ splice site, ligating the first nucleotide of the intron and the branch point A to form a lariat structure, and cleaving the 5’ exon from the intron. In the second step, the 3’-OH of the detached exon attacks the phosphate at the 3’ end of the intron, ligating the two exons and releasing the intron, still in the form of a lariat.
 
In mammalian splice sites, the sequences adjacent to the invariant dinucleotides are not strictly conserved, with humans having a median splice site consensus value of 82 and 80 for 5’ and 3’ splice sites, respectively (100 being perfect consensus and 0 being worst consensus based on the relative contributions of each position compiled for thousands of introns) (30). Splice site choice is controlled by assembly of the spliceosome. The degree to which splice sites conform to the best consensus sequence determines their efficiency in recruitment and assembly of the spliceosome, and thus their intrinsic capacity to direct splicing. However, additional elements modulate splice site selection, activating or repressing certain splice sites.  ESEs and ISEs (exonic and intronic splicing enhancers) and ESSs and ISSs (exonic and intronic splicing silencers) are short sequences within the pre-mRNA that recruit RNA binding proteins to promote or repress spliceosome assembly at overlapping or adjacent sites. Splicing silencers and enhancers are important in the regulation of both constitutive and signal-induced splicing. Whereas the SR proteins typically bind to splicing enhancers and stimulate the binding of U2AF, U2 snRNP, or U1 snRNP (31), the family of hnRNP proteins binds to splicing silencers and repress specific splice sites (6).
 
More than half of the major hnRNPs have been demonstrated to play a role in splicing, one which is typically negative. Study of these proteins has revealed several strategies utilized by hnRNPs to inhibit the splicing reaction, either constitutively or at specific splice sites (i.e. splice site selection). hnRNP binding can directly block the binding of splicing factors, spliceosome components, or positive splicing regulators to the pre-mRNA. For example, the binding of hnRNPA1 to an ESE in exon 2 of the tat transcript of HIV-1 interferes with recruitment of the U2 snRNP (32-35) and the SR protein SC35 (36). PTB can also interfere with the binding of U2AF (a key factor in spliceosome assembly; recognizes the 3’ splice site and polypyrimidine tract) at the polypyrimidine tract of α-tropomyosin pre-mRNA (37;38). hnRNPs can cooperatively bind to adjacent sites on the pre-mRNA, creating a zone of local repression. This may occur when one high affinity site is flanked by several lower affinity sites, allowing propagative binding of the hnRNP over a distance. Spliceosome assembly at splice sites distant from the high affinity site can then be blocked (39). Rather than physically blocking their binding, another means by which hnRNPs may repress splicing is by interfering with interactions between spliceosome components across introns or exons. PTB binding to ISEs in the c-src pre-mRNA does not prevent binding of either the U1 snRNP or U2AF, but instead prevents U1 snRNP from making productive cross-intron interactions with U2AF (40). Finally, hnRNPs bound to different introns have been proposed to interact with each other, thereby looping out the intervening RNA sequence and promoting exon skipping (41;42).
 
HNRPLL was cloned in 2004 from a bone marrow stromal cell cDNA library (13). Since then it has been found to regulate the alternative splicing of a large number of transcripts, the best studied being that of CD45 (1;43;44). CD45 is an alternatively spliced transmembrane phosphatase that positively regulates antigen receptor signaling in T cells (45). CD45 isoforms are generated by alternative splicing of at least three exons (4, 5, and 6), which encode peptides (designated A, B, and C, respectively) ~50 amino acids in length.  Each exon contains at least one ESS that promotes exon skipping, and an activation-responsive sequence (ARS) that promotes skipping in response to T cell activation (2-4). The protein isoforms are commonly named based on the exons included, with the largest isoform (RABC) including all three exons, RAB including exons 4 and 5, etc., and the smallest isoform lacking all three exons designated RO.  Knockdown of hnRNPLL expression by short hairpin RNA (shRNA) in the T cell line JSL1 significantly reduces PMA-induced CD45RO expression, but increases CD45RA expression (43). Consistent with this, expression of Hnrpll mRNA, but not mRNA encoding hnRNPL, is upregulated 2-fold 24 hours after PMA stimulation of JSL1 cells (43), and is expressed at 3-fold higher levels in memory T cells relative to naïve T cells (1). Primary human CD4+ T cells also upregulate CD45RO and downregulate CD45RA upon knockdown of hnRNPLL. Notably, B cells, which normally express only the CD45RABC isoform and lack a Ptprc exon-silencing factor (46), were found to express very low levels of hnRNPLL (1). In addition to hnRNPLL, its closest relative hnRNPL and the splicing factor PSF were found to bind to the ARSs of each of the three Ptprc variable exons and repress exon inclusion in vitro (JSL1 nuclear extract incubated with model RNA substrates) (4;47;48). However, expression of hnRNPL was not found to increase in response to T cell activation, overexpression of hnRNPL has no effect on CD45 isoform expression, and the nuclear concentration of PSF does not change upon cell activation (1;43;48).  The phenotype of thunder mice strongly suggests that hnRNPLL is the key inducible silencing factor for Ptprc alternative exons in T cells in vivo (1). It may function together with hnRNPL and PSF to control Ptprc alternative splicing.
 
In addition to silencing CD45 exons, hnRNPLL was also found to act as a global regulator of T cell splicing. Exon array experiments in wild type versus Hnrpllthunder/thunder mouse T cells (1), or hnRNPLL-depleted versus control human peripheral T cells (43), demonstrated alternative exon usage in hundreds of transcripts, including Ptprc, when cells lacked functional hnRNPLL. Both exon inclusion and exclusion were observed in the transcripts, suggesting that hnRNPLL can act as both a splicing enhancer and silencer. For unknown reasons, the identity of the transcripts affected by hnRNPLL deficiency differed substantially between the two studies. In addition, human peripheral T cells in which hnRNPLL was knocked down proliferated poorly, in contrast to Hnrpllthunder/thunder mouse T cells, which proliferated normally (but failed to accumulate). Nevertheless, the data confirm a broad role for hnRNPLL in alternative splicing in T cells.
 
Mutations in the cis- and trans-acting factors that control splicing are a primary cause of many diseases (49). The effects of cis- versus trans-acting mutations can be quite different: in the case of cis-acting mutations, only the mutated allele is affected, but when a trans-acting factor is mutated, the expression of many genes may be affected. Recent estimates are that 50-60% of disease-causing mutations disrupt cis-acting splicing regulatory elements (50;51). Many of these elements are exonic, mutations of which are typically assumed to directly affect protein function rather than splicing (and in turn, expression and isoform expression). For example, one fourth of synonymous mutations in exon 12 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene result in exon skipping and an inactive CFTR protein, causing cystic fibrosis (OMIM #219700) (52;53). Trans-acting mutations affect the splicing machinery or its regulatory proteins and cause disease. An example is spinal muscular atrophy (OMIM #253300), caused by mutations in the survivor of motor neuron-1 (SMN1) gene, which is required for assembly of snRNPs (54). Retinitis pigmentosa (OMIM #600138, #600059, #601414) is caused by mutations in pre-mRNA processing factor gene homologues PRPF31, PRPF8, and PRPF3, encoding proteins required for assembly and function of the U4/U5/U6 snRNP (55).  Finally, both cis- and trans-acting splicing mutations can cause cancer (56-58).
Putative Mechanism
The thunder mutation in valine136 is located within loop β1/α1, connecting strand β1 to helix α1, in the first predicted RRM (RRM1) of hnRNPLL. Analysis of the NMR structure of the mutant RRM1 demonstrated that it adopts the canonical RRM fold (1), as seen for RRM1 of PTB (59). Although the V136 side chain is buried and could therefore disrupt the structure of RRM1, NMR spectra revealed changes only in the vicinity of helix α1, which packs against the β sheet that makes primary contacts with the RNA. NMR spectroscopy and isothermal calorimetry experiments indicated that the wild type hnRNPLL RRM1 binds to the ARS from exon 6 of CD45 with an affinity similar to that of other isolated RRMs (Kd values of 1-3 μM), and that the mutant RRM1 displays similar binding characteristics. Mutation of the ARS sequence prevented binding. Thus, the structure of the hnRNPLL RRM1 RNA-binding region and its affinity for a specific RNA substrate are not significantly affected by the thunder mutation. Rather, differential scanning calorimetry demonstrated that the mutation results in a much lower melting temperature. A significant degree of unfolding above 25°C was observed for the mutant RRM, whereas the wild type RRM was stable up to at least 45°C. The thunder mutation is therefore thought to prevent binding to RNA by interfering with proper protein folding at 37°C.
Primers Primers cannot be located by automatic search.
References
Science Writers Eva Marie Y. Moresco
AuthorsZuopeng Wu, Xinying Jia, Laura de la Cruz, Xun-Cheng Su, Bruz Marzolf, Pamela Troisch, Daniel Zak, Adam Hamilton, Belinda Whittle, Di Yu, Daniel Sheahan, Edward Bertram, Alan Aderem, Gottfried Otting, Christopher C. Goodnow, Gerard F. Hoyne
List [record 98 of 0]
Edit History
2011-01-04 2:55 PM (current)
2010-11-03 3:26 PM
2010-11-03 1:04 PM
2010-09-02 7:57 PM
2010-04-08 5:02 PM
2010-02-03 4:39 PM