Phenotypic Mutation 'pale_rider'

• Allele: pale_rider
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 87,087,231 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Tyr
• Gene Name: tyrosinase
• Synonym(s): skc35, Oca1
• Chromosomal Location: 87,073,979-87,142,637 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Aspartic acid
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P11344
• SMART Domains: Protein: ENSMUSP00000004770; Gene: ENSMUSG00000004651; AA Change: V427D

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	91	112	N/A	INTRINSIC
Pfam:Tyrosinase	170	403	4.8e-45	PFAM
transmembrane domain	474	496	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000004770)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.148)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 038249-MU
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: 2010-02-02 9:38 PM by Carrie N. Arnold
• Record Posted: 2010-04-06
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Carrie N. Arnold and Elaine Pirie

Accession Number

NCBI RefSeq: NM_011661; Ensembl: ENSMUST00000004770; MGI: 98880

Alleles Listed at MGI

All alleles(104) : Spontaneous(26) Chemically induced(9) Radiation induced(69) Other(1)  

Phenotypic Description

Pale rider homozygotes exhibit albinism with white fur and red eyes.

Nature of Mutation

Due to phenotypic similarities with other Tyr mutant animals, the Tyr gene was directly sequenced as a candidate gene, and a T to A transversion was found at position 1341 of the Tyr transcript in exon 4 of 5 total exons. 

 

1325 AGAGACTCTTACATGGTTCCTTTCATACCGCTC

422  -R--D--S--Y--M--V--P--F--I--P--L-

 

The mutated nucleotide is indicated in red lettering, and causes a valine to aspartic acid substitution at residue 427 of tyrosinase.

 

Protein Prediction

Figure 1. Domain structure of tyrosinase. The pale rider mutation causes a valine to aspartic acid substitution at residue 427 of tyrosinase. SP, signal peptide; EGF-like, epidermal growth factor-like laminin domain; TM, transmembrane; CT, cytoplasmic tail. Glycosylation and copper binding sites are indicated in light and dark pink, respectively. Click on the image to view other mutations found in TYR. Click on each mututation for more specific information.

The residue altered by the pale rider mutation occurs in the lumenal region of tyrosinase C-terminal to the active site (Figure 1).  This residue is highly conserved in vertebrates.

Please see the record for ghost for more information on the Tyr gene 

Primers

Primers cannot be located by automatic search.

Genotyping

Pale rider genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

PaleR(F): 5’- GCCCACCATTAGGATGGATTTCCAC -3’

PaleR(R): 5’- TGACTAGGAAGGCCAAAGCCCATAG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

PaleR _seq(F): 5'- GGTAGGCTCTGCCTTAAAAAC -3'

PaleR _seq(R): 5’- AGGCAACTGAGCTTTACCTG -3’

 

The following sequence of 1387 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7, bases 94,585,858 to 94,587,244) is amplified:

 

                                         gcc caccattagg atggatttcc actgtccttg gtttgtttgt

ttgtttgttt gtttgttttg ttttggtcgc tatttcctat tcctagaatg gttttgtctt

gttgcctgaa tagtagtcat gtggtcacat aaaagcttta tgggaagctg gaaatgggct

gtttcatctt ctatcattaa aggtaggctc tgccttaaaa acatgatctt tcctaaccat

aagacaaaga ctgaaatacc tgatatagag aaaaacaaaa agtgattatg gtctagtctt

ttgtcaattt agttttatat ggtttttctt ttgactttct ttgcattttt aaagttatat

ttaatattat gacaatattt catgaaaaca aatgttgaat tctgaaacct ctatactatc

tataaaagtt taattttcat aaggaaaatt tgaagttatc ctcacactac ttctgatgaa

tgaccttctt caggacatga aattgtaact tgtcaaagtt tgaagatagc acttgatcaa

gtcttgtgat atcaataatt gtcttttaag aacttaaaat ttacacctta taaataaaat

gttcctgact ctgagtaacc cttccctctg tagtattttt gaacaatggc tgcgaaggca

ccgccctctt ttggaagttt acccagaagc caatgcacct atcggccata acagagactc

ttacatggtt cctttcatac cgctctatag aaatggtgat ttcttcataa catccaagga

tctgggatat gactacagct acctccaaga gtcaggtaaa gctcagttgc cttcagatga

actatggaat gcaatgtggg taacctcttt gggggcagtt aaaaacacct actgtatact

caattttttt tctaaaactt ctaaagaaac tatattatgc caatttataa ttgtgtaaac

tagaactgta tttcaatgat tcctaaattt ataactattc catctagtat aggaatttta

tacagttaaa ttgttgaaga atataggatt gggaagcttt tgaaccatga attccaatga

attatgtcag ctgttttatg acctagggat attctttcaa ttctgtgaat catattttat

tcattatata tttagatagg aataactgta tttttctgaa tcaggttaaa gaattcagtc

tacgaatcat atggtattaa caatttgtga tcttccatct tgagactctt ggtaggatta

ccaatgcaat aatggaaact ttcaaaatga actaatattg ggtttcataa taattcttta

atgttaacta ttataccttt ggctagaagc ataatgtaaa gccttaggac tggaagtagc

tatgggcttt ggccttccta gtca

         

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.