Phenotypic Mutation 'frizz'

• Allele: frizz
• Mutation Type: splice site (11 bp from exon)
• Chromosome: 11
• Coordinate: 34,258,184 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Dock2
• Gene Name: dedicator of cyto-kinesis 2
• Synonym(s): CED-5, MBC, Hch
• Chromosomal Location: 34,226,815-34,783,892 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016] ; PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8C3J5
• SMART Domains: Protein: ENSMUSP00000090884; Gene: ENSMUSG00000020143

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	2e-113	PFAM
Pfam:DOCK-C2	419	616	1e-60	PFAM
Pfam:DHR-2	1114	1614	6.3e-96	PFAM
low complexity region	1691	1706	N/A	INTRINSIC
low complexity region	1793	1800	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 036114-MU
• Last Updated: 2019-05-21 7:37 PM by Diantha La Vine
• Record Created: 2010-03-15 3:55 PM by Carrie N. Arnold
• Record Posted: 2011-07-06
• Science Writers: Nora G. Smart
• Illustrators: Katherine Timer
• Authors: Carrie N. Arnold, Elaine Pirie, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_033374; MGI: 2149010

Alleles Listed at MGI

All alleles(18) : Targeted(4) Gene trapped(11) Spontaneous(1) Chemically induced(2)

Phenotypic Description

Figure 1.

Figure 2.

The frizz mutation was discovered while analyzing N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice using flow cytometry analysis of blood.  Frizz animals have reduced frequencies of peripheral CD4+ and CD8+ T cells and low expression of B220 (the B cell form of CD45; see the record for belittle), suggesting a block in B cell maturation (Figure 1).  In addition, these animals lack a T-dependent immunoglobin (IgG) response to model antigens encoded by a recombinant nonreplicating vector based on the Semliki Forest Virus (rSFV), but make normal T-independent IgM responses to haptenated ficoll (Figure 2).  The frizz phenotype is similar to that of frazz mutants with a mutation in the Dock2 gene.  Complementation testing between the two strains confirmed that frizz is also an allele of Dock2.

Nature of Mutation

Whole genome sequencing of a homozygous frizz mouse using the SOLiD technique covered the coding/splicing region at least 1x or 3x with 75.9% and 46.5% coverage, respectively.  Validation sequencing using the Sanger method was attempted on all nucleotides for which discrepancies were seen at 3x or greater coverage, with 69 of 84 discrepancies successfully processed and mutations in three genes were identified. Whole genome sequencing did not identify the causative mutation in Dock2.  Standard Sanger sequencing of the Dock2 gene identified a T to A transversion at position 34158184 in the GenBank genomic region NC_000077 for the Dock2 gene on chromosome 11 (TGATCCCATAG  -> AGATCCCATAG) (Figure). In GenBank, the mutation is located near the acceptor splice site of intron 16 (intron 38 in Ensembl record ENSMUST00000093193) from the ATG exon, eleven nucleotides to the next exon.  Dock2 contains 30 exons according to Genbank record NM_033374 and 52 exons according to Ensembl record ENSMUST00000093193.  Multiple Dock2 transcripts are displayed on Ensembl and Vega. The effect of the mutation at the cDNA and protein level is currently being determined.  One possibility, shown below, is that aberrant splicing may result in skipping of the 90 bp exon 39, utilization of the acceptor splice site from intron 39 and in-frame splicing to exon 40 (depicted below as seen on Ensembl). This would result in deletion of 30 amino acids.

 

    <--exon 38 <--intron 38 exon 39-->  exon 40--> <--exon 52

     CACCAACAG……TGATCCCATAG ATGTGGGAA………ACCCAGCAG………AACATGTGA

1289 -K--G--K-              -M--W--E-   -T--Q--Q-………-N--M--*  1828

      correct                deleted          correct

       
The acceptor splice site of intron 38, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain structure of mouse DOCK2, a member of the DOCK A subfamily. DOCK A proteins contain an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The frizz mutation causes a T to A transversion near the acceptor splice site of intron 16, eleven nucleotides to the next exon. The mutation may result aberrant splicing and skipping of exon 17. This image is interactive. Other mutations found in DOCK2 are noted in red. Click on each mutation for more specific information.

The frizz mutation likely results in abnormal splicing of Dock2 and may cause an internal deletion of amino acids 1292-1321 in the DHR-2 domain.

 

For more information on the Dock2 gene, see the record for frazz.

Primers

Primers cannot be located by automatic search.

Genotyping

Frizz genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

 

Primers

Frizz(F): 5’- GATGCTCACCAAGACCTCATCAGG -3’

Frizz(R): 5’- GCGCAGATGACTCTCCATTTCTCAC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

Frizz_seq(F): 5'- AGACCTCATCAGGCCCTTC -3'

Frizz_seq(R): 5'- TCTCTCCCAGTACTTAGGAAGATCAG -3'

 

The following sequence of 513 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 34,157,954 to 34,158,466) is amplified:

 

gcgcagatga ctctccattt ctcacctaga gtgtaggtct gatgttagtg acctctctcc
cagtacttag aagatcaga gcacatgtaa acaagttact ccattattca gtaaaggagc
tggttagaaa gccaggggaa gtttgtacta ctaccaaggc ccgctctgtg tgagcactag
gtaagaagct gtctgcggtg caacgggcga tggcaaggct caagtccctc cttcagcaaa
ggctctgaaa agttggacca cctctaacca ctgtccccat gatgatccca tagatgtggg
aagaggccat cagcctgtgc aaggaactgg cggaacaata tgagatggag atctttgact
acgagctact cagccagaac ctggtaaggc tctcccaaga aagccatgca cgccacacac
gcggtgctcg ctcagctcag agacagaagc gaggcccgtg ggttagggag acagaagact
ggggaagggc ctgatgaggt cttggtgagc atc

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.