Phenotypic Mutation 'Cpg11'

• Allele: Cpg11
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 106,224,586 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Tlr9
• Gene Name: toll-like receptor 9
• Chromosomal Location: 106,222,598-106,226,883 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION] Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION] Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION] Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION] Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

• SMART Domains: Protein: ENSMUSP00000082207; Gene: ENSMUSG00000045322; AA Change: S359P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000062241)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.083)
• Candidate Explorer Status: CE: no linkage results
• Penetrance: unknown
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm, gDNA
• MMRRC Submission: 034329-JAX
• Last Updated: 2016-05-13 3:09 PM by Anne Murray
• Record Created: 2010-04-20 11:48 AM by Hua Huang
• Record Posted: 2010-04-29
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Hua Huang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Phenotypic Description

The CpG11 phenotype was identified in a screen for ENU-induced homozygous mutants with impaired responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from the index CpG11 mouse (G4562) produced normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODNs). CpG11 heterozygotes produced intermediate levels of TNF-α relative to wild type and CpG11 homozygotes, demonstrating that the mutation is semidominant (Figure 1).

Nature of Mutation

The candidate gene Tlr9 was sequenced directly, and a T to C transition was identified at position 1181, in exon 2 of 2 total exons.

1166 CTCCACCTGGCAAGTTCCTTTAAGAACCTGGTG
353  -L--H--L--A--S--S--F--K--N--L--V-

The mutated nucleotide is indicated in red lettering, and results in a serine to proline substitution at amino acid 359 of the TLR9 protein.

 

Please see the record for CpG1 for more information about Tlr9.

Protein Prediction

Figure 2. Protein and domain structure of TLR9. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG11 mutation is shown in red. 3D image was created using UCSF Chimera. B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and an cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The CpG11 mutation (red asterisk) results in a serine to proline substitution at amino acid 359 of the TLR9 protein in the predicted eleventh leucine rich repeat (LRR). This image is interactive. Click on the image to view other mutations found in TLR9 (red). Click on the mutations for more specific information.

The extracellular domains of TLRs contain multiple leucine rich repeats (LRRs) that mediate ligand recognition by TLRs. TLR9 has 25 LRRs in its ectodomain. The CpG11 mutation is located in the predicted eleventh leucine rich repeat (LRR) of the TLR9 ectodomain (Figure 2).

Putative Mechanism

Based on the 3D structures of TLR1, TLR2 (1), TLR3 (2-4), and other LRR-containing proteins (5), the serine mutated in CpG11 is predicted to lie in the surface-exposed α-helical second leucine-rich sequence of the affected LRR, at a position thought to permit occupancy by any amino acid, but adjacent to an invariant phenylalanine. The CpG11 phenotype indicates that a proline at this position fails to support normal function of TLR9. The mutation may disrupt ligand binding, receptor dimerization, or destroy proper folding or localization of the receptor.

Primers

Primers cannot be located by automatic search.

Genotyping

CpG11 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide insertion.

 

Primers

CpG11 (F): 5’- CATGGACGGGAACTGCTACTACAAG -3’

CpG11(R): 5’-ATGAAGTTCTTAGAAGCAGGGGTGC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

CpG11_seq(F): 5’- TGAGCAATCTCACCCATCTG -3’

CpG11_seq(R): 5’- GACAACAGCTCCTCCTGCTC -3’

 

The following sequence of 885 nucleotides (from Genbank genomic region NC_­­­­­000075 for linear genomic sequence of Tlr9, sense strand) is amplified:

 

1433                                                          catggacg

1441 ggaactgcta ctacaagaac ccctgcacag gagcggtgaa ggtgacccca ggcgccctcc

1501 tgggcctgag caatctcacc catctgtctc tgaagtataa caacctcaca aaggtgcccc

1561 gccaactgcc ccccagcctg gagtacctcc tggtgtccta taacctcatt gtcaagctgg

1621 ggcctgaaga cctggccaat ctgacctccc ttcgagtact tgatgtgggt gggaattgcc

1681 gtcgctgtga ccatgccccc aatccctgta tagaatgtgg ccaaaagtcc ctccacctgc

1741 accctgagac cttccatcac ctgagccatc tggaaggcct ggtgctgaag gacagctctc

1801 tccatacact gaactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa

1861 gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc

1921 tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc

1981 tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatcttct

2041 tccgcttgct caacaagtac acgctcagat ggctggccga tctgcccaaa ctccacactc

2101 tgcatcttca aatgaacttc atcaaccagg cacagctcag catctttggt accttccgag

2161 cccttcgctt tgtggacttg tcagacaatc gcatcagtgg gccttcaacg ctgtcagaag

2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc

2281 cagctccgct gagcacccct gcttctaaga acttcat

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

1. Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide. Cell. 130, 1071-1082.

2. Bell, J. K., Botos, I., Hall, P. R., Askins, J., Shiloach, J., Segal, D. M., and Davies, D. R. (2005) The Molecular Structure of the Toll-Like Receptor 3 Ligand-Binding Domain. Proc. Natl. Acad. Sci. U. S. A. 102, 10976-10980.

3. Choe, J., Kelker, M. S., and Wilson, I. A. (2005) Crystal Structure of Human Toll-Like Receptor 3 (TLR3) Ectodomain. Science. 309, 581-585.

4. Liu, L., Botos, I., Wang, Y., Leonard, J. N., Shiloach, J., Segal, D. M., and Davies, D. R. (2008) Structural Basis of Toll-Like Receptor 3 Signaling with Double-Stranded RNA. Science. 320, 379-381.

5. Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-Rich Repeats and Pathogen Recognition in Toll-Like Receptors. Trends Immunol. 24, 528-533.