Phenotypic Mutation 'murdock' (pdf version)
List |< first << previous [record 3 of 7] next >> last >|
Allelemurdock
Mutation Type missense
Chromosome1
Coordinate36,779,704 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539; MGI: 99613

Mapped Yes 
Amino Acid Change Isoleucine changed to Phenylalanine
Institutional SourceAustralian Phenomics Network
Ref Sequences
I367F in Ensembl: ENSMUSP00000027291 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
(Using Ensembl: ENSMUSP00000027291)
Phenotypic Category
Phenotypequestion? Literature verified References
CD8 response - decreased
FACS CD4+ T cells - decreased
FACS CD8+ T cells - decreased
immune system
Penetrance 100% 
Alleles Listed at MGI
All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

Australian PhenomeBank: 159

Last Updated 2017-08-08 8:05 PM by Diantha La Vine
Record Created 2010-05-25 3:16 PM by Nora G. Smart
Record Posted 2010-05-28
Phenotypic Description
The murdock (mrd) phenotype was identified in a flow cytometry screen of blood from N-ethyl-N-nitrosourea (ENU)-mutagenized mice for mutations affecting the circulating proportions of memory and naïve T cells (1).  Homozygous murdock mice display an increased percentage of CD4+ and CD8+ cells expressing high levels of CD44 (a marker of activated and memory T cells), resulting from a reduction in the absolute number of CD44lo (naïve) cells in the peripheral blood, spleen, and lymph node.  These animals exhibit an overall reduction of CD4+ T cells due to the decrease in naïve cells, while the percentage of CD8+ T cells remains normal.  The absolute numbers of activated and memory CD4+ T cells is normal, while activated and memory CD8+ T cells are increased (Figure 1A).    
 
Murdock animals were crossed with a second mouse strain bearing a mutant copy of Zap70, known as mrtless (mrt).  The Zap70mrt allele reduces ZAP-70 protein expression to 25% of the wild-type levels and almost completely arrests T cell development at the CD4+CD8+ double positive (DP) stage resulting in very few peripheral T cells (please see background for a description of T cell development) (Figure 2A). Compound heterozygous Zap70mrd/mrt offspring display a 60% decrease in naïve CD4+ T cells relative to Zap70mrd/mrd mice, but also have normal numbers of activated and memory CD4+ T cells as well as an increased number of activated CD8+ T cells (Figure 1B,C).  During T cell development, Zap70mrd/mrd animals displayed normal numbers of CD4+ CD8+ double positive (DP) and CD8+ T cells in the thymus.  The formation of DP cells remains unaffected by compound heterozygosity, while CD8+ T cell numbers are only slightly decreased.  However, CD8+ T cells are almost completely abolished in Zap70mrt/mrt mice.  By contrast, CD4+ T cell development is differentially affected by all three genotypes in a stepwise manner (Figure 2A,B).  Similarly, these genotypes exhibit stepwise reductions in the expression of T cell markers (Figure 2C) and varying degrees of T cell receptor (TCR)-induced responses.  The TCR-induced calcium flux in Zap70mrd/mrd CD4+ T cells is nearly normal, but dramatically decreased in Zap70mrd/mrt cells (data not shown).  Zap70mrt/mrt thymocytes have greater responsiveness to TCR stimulation than thymocytes with complete ZAP-70 deficiency as judged by the expression of CD5 and CD69, which are upregulated after T cell activation (data not shown).
 
Unlike the parental strains, compound heterozygous animals develop IgG autoantibodies reactive to cytoplasmic or nuclear antigens, and also spontaneously produce greatly increased amounts of IgE, which plays a role in allergy, and IgG1 in their serum, suggesting dysregulated immune activity.  Conversely, compound heterozygotes exhibit diminished IgG antibody responses to immunization likely due to impaired helper T cell function.  Antibody responses to the T-independent antigen NP-Ficoll were normal for all of these Zap70 mutant strains suggesting that B cell function remains unaffected (Figure 3).  In order to understand why compound heterozygotes selectively triggered autoimmune phenotypes, negative selection of autoreactive T cells was examined in these animals.  This was done by analyzing polyclonal T cell populations expressing Vβ5 or Vβ11 TCRs with a range of affinities for mouse mammary tumor virus (MMTV) self-superantigen complexed with I-E or I-A major histocompatibility complex (MHC) molecules. In mice with wild-type Zap70, a large subset of peripheral T cells express Vβ5 or Vβ11 in I-E deficient H2b animals that express only I-A, which presents the self-superantigen inefficiently (Figure 4, open circles). These Vβ5+ or Vβ11+ cells are negatively selected in H2k animals expressing I-E, which efficiently presents self-superantigen to T cells (Figure 4, filled circles). In this system Zap70mrd/mrd mice displayed impaired negative selection of some T cell subsets but not others, while Zap70mrd/mrt animals displayed impaired negative selection for all autoreactive T cells examined.  In some cases, this defect is quantitatively worse than the defect observed for the parental murdock strain (Figure 4).  Both Zap70mrd/mrd and Zap70mrd/mrt animals are defective for positive selection of CD4+ T cells.
 
The above data suggest that the autoimmune phenotypes displayed by Zap70mrd/mrt mice may be due to impaired negative selection of autoreactive T cells.  However, self-tolerance and suppression of IgG and IgE secretion can also be regulated by CD4+ Foxp3+ regulatory T cells (Tregs; see the record for crusty) (2). The absolute number of these cells in the thymus was reduced 4-fold in Zap70mrd/mrd animals, somewhat less than the overall reduction of CD4+ thymocytes, while Treg numbers were much more severely reduced in double heterozygous animals to 10% of normal levels.  In the spleen, however, CD4+Foxp3+ T cells were present in normal numbers in both Zap70mrd/mrd and Zap70mrd/mrt animals (Figure 5A).  However, Zap70mrd/mrt regulatory T cells expressed much lower amounts of CD25 relative to Zap70mrd/mrd or wild-type T cells (Figure 5B), suggesting that a defect in Treg function may contribute to the autoimmune phenotypes found in these mice.  However, Zap70mrd/mrt Tregs are apparently functional as reconstitution of lymphopenic Rag1-/- mice (see the record for maladaptive) with a mixture of Zap70mrd/mrt and Foxp3-/Y splenocytes resulted in healthy animals, while mice reconstituted with 100% Foxp3-/Y developed an autoimmune syndrome due to the lack of functional Tregs (data not shown).  Furthermore, hyper-IgE occurred in all Zap70mrd/mrt reconstituted animals even in mixed chimeras with wild-type cells suggesting that the autoimmune defects observed in Zap70mrd/mrt mice are cell-autonomous (Figure 5C).
Nature of Mutation
The murdock mutation was mapped to Chromosome 1, and corresponds to an A to T transversion at position 1207 of the Zap70 transcript, in exon 9 of 13 total exons.
 
1192 CAGATTGACGTGGCCATCAAGGTGCTGAAGCAG
362  -Q--I--D--V--A--I--K--V--L--K--Q
 
The mutated nucleotide is indicated in red lettering and causes an isoleucine to phenylalanine change at amino acid 367 of the encoded protein.
Protein Prediction
Figure 7. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The murdock mutation causes an isoleucine to phenylalanine change at amino acid 367. The 3D structure is human ZAP70.UCSF Chimera structure based on PDB 2OZO. This image is interactive. Click on the image to view other mutations found in ZAP-70 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.
The ζ-associated protein of 70 kDa (ZAP-70) is a protein tyrosine kinase (PTK) that binds to the doubly phosphorylated immunoreceptor tyrosine-based activation motifs (ITAMS) of ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse). ZAP-70 recruitment to the TCR complex also appears to be dependent upon its interaction with ITAMs present within RhoH, a GTPase-deficient member of the Rho GTPase family (3;4). The 618 amino acid ZAP-70 and spleen tyrosine kinase (Syk) are the only two members of the Syk family of PTKs, and consist of two N-terminal Src-homology 2 (SH2) domains at amino acids and a C-terminal kinase domain (Figure 7). The SH2 domains are connected by a linker known as interdomain A, while the region between the second SH2 and catalytic domains is known as interdomain B (5-7). Murine ZAP-70 shares 93% amino acid identity with the human ZAP-70 sequence (8).
 
The two SH2 domains of mouse ZAP-70 occur at amino acids 10-102 and 163-254, and work cooperatively to bind to the phosphorylated tyrosines of an ITAM sequence [(D/E)xxYxxI/Lx(6-8)YxxI/L] (9). A structure of the ZAP-70 SH2 domains in complex with a peptide derived from the TCR ζ subunit suggests that interdomain A forms a rigid coiled coil α-helical structure that is important in forming an interface between the two SH2 domains, while the two SH2 domains contain six β strands packed between two α helices. The N-terminal SH2 domain has an incomplete phosphotyrosine-binding pocket that is completed by the surface of the second SH2 domain. When bound to the ITAM sequence, both SH2 domains make extensive contacts with each other and the ITAM (10). In the unbound state, the interdomain A region forms a much more flexible structure (11)
 

Figure 8. Inactive and active kinase domain of ZAP-70. The murdock and mrtless mutations are noted in red. UCSF Chimera structure is based on Yeung et al. Immunological Reviews 228, 41-57 (2009); PBD 2OZO and 1U59.

The recruitment of ZAP-70 via its SH2 domains to the TCR receptor complex allows ZAP-70 to be activated by phosphorylation and also relieves an autoinhibited conformation of the kinase (see below). ZAP-70 is phosphorylated on multiple tyrosines by the Src family kinase (SFK) Lck (see the record for iconoclast), the kinase c-Abl, or by trans-autophosphorylation of tyrosines present in the activation loop of its kinase domain (Tyr 492 and Tyr 493) (12-14). Phosphorylation of Tyr 493 is required for ZAP-70 activation, while Tyr 492 phosphorylation negatively regulates ZAP-70 function (15-17). Phosphorylation of these two tyrosines could displace the activation loop from the catalytic site of the kinase. However, crystal structure analysis of the ZAP-70 kinase domain in complex with an inhibitor suggests that the activation loop can adopt an active and open conformation, even without phosphorylation of Tyr 492 and Tyr 493 (18) (Figure 8). Conformational changes in the SH2 domains and interdomain B are likely to play a role in ZAP-70 autoinhibition instead (19). The kinase domain of ZAP-70 (amino acids 337-597) has the characteristic protein kinase structure with an N-terminal lobe composed of a five-stranded antiparallel β-sheet and a single helix (known as αC), and a predominantly helical C-terminal lobe with short β-sheets. An extended linker connects these lobes, and the ATP-binding site is located at the junction between the two lobes, and is stabilized by a glycine-rich segment and by direct binding to the catalytic loop of the kinase (18). The aspartic acid (D) of the catalytic DLARRN loop (residues 460-465) is the proton acceptor during the catalytic cycle and mutation of the highly conserved arginine (R) residue in this motif results in kinase inactivation (20;21).  
 
In addition to Tyr 492 and Tyr 493, ZAP-70 contains several additional tyrosine residues located within interdomain B that are phosphorylated following TCR stimulation (Tyr 292, Tyr 315, and Tyr 319) [reviewed by (6;7)]. When phosphorylated, these tyrosines interact with important downstream signaling molecules, including the E3 ubiquitin-protein ligase c-Cbl, the guanine nucleotide exchange factors (GEFs) Vav1 and SOS (Son of Sevenless) that activate the Rho and Ras family of GTPases, respectively, the adaptor protein CT10 regulator of kinase II (CrkII), Lck, and phospholipase C γ1 (PLC-γ1) [reviewed by (6)].  Mutation of Tyr 292 to a structurally related, but unphosphorylatable phenylalanine, resulted in enhancement of some aspects of TCR signaling although other aspects were not severely affected (17;22). Tyr 292 has been shown to bind to c-Cbl, which may result in ubiquitination and downregulation of the TCR (23;24). Phosphorylated Tyr 315 binds to the SH2 domain of Vav1 and to CrkII, and is essential for antigen receptor-mediated signal transduction and recruitment of Vav1 and SOS in T cells (25-28). CrkII binding may link TCR stimulation with actin reorganization as Crk proteins are associated with cytoskeletal remodeling. A complex consisting of Crk-like (Crk-L), Wiskott-Alrich syndrome protein (WASP; OMIM #301000) and WASP-interacting protein (WIP) has been shown to associate with ZAP-70 (29). Tyr 315 may also play a role in TCR-mediated activation of integrin function as mutation of this residue impairs TCR stimulation-induced T cell adhesion to fibronectin, but other studies suggest that ZAP-70 is not critical for T cell adhesion (30-32). Mutational analysis of Tyr 319 suggests that this residue is a binding site for the SH2 domain of Lck, as well as the C-terminal SH2 domain of PLC-γ1 (12;25;33).
 
Regulation of ZAP-70 kinase activity is also dependent on these tyrosine residues as mutation of both Tyr 315 and Tyr 319 to phenylananine renders the kinase inactive. In contrast, mutation of these same residues to alanine results in increased basal kinase activity (34).  Additionally, some function is maintained in a mutant lacking most of interdomain B, suggesting that it may be involved in an autoinhibitory mechanism (35).  It is likely that mutation of Tyr 315 and Tyr 319 to phenylalanine stabilizes an autoinhibited conformation that is disrupted by tyrosine phosphorylation. Crystallization studies of a mutant ZAP-70 protein containing these phenylalanines suggests that in its autoinhibited form, the SH2 domains of ZAP-70 adopt a conformation that is incompatible with ITAM binding (19). In this inactive conformation, the αC helix of the N-terminal lobe of the kinase domain is rotated away from the active site, removing a conserved glutamate residue (Glu 386) and disrupting a crucial salt bridge that this residue forms with a conserved lysine residue (Lys 369) from strand β3 in the active conformation (Figure). The Glu/Lys ion pair is necessary for coordinating the α- and β-phosphates of ATP. In addition, hydrophobic residues of a short 310-helix at the base of the activation loop, immediately following the conserved Asp-Phe-Gly (DFG) motif (amino acids 478-480), packs against the displaced αC helix and stabilizes its displaced position. The N-lobe of the kinase domain forms a closed conformation over the C-lobe. Autoinhibited ZAP-70 is also stabilized by the docking of two α-helices from interdomain A onto the C-terminal lobe of the kinase domain via a proline residue that wedges between two tyrosines on the back of the C-lobe.  Critical residues stabilizing the structure include interactions between the mutated interdomain B tyrosines, and Trp 131 and Pro 296 (19;36)
 
Once activated, ZAP-70 interacts with and phosphorylates a number of substrates important for TCR signaling including the adaptor proteins the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (37;38). The phosphorylated tyrosines of ZAP-70 are dephosphorylated by the SH2 domain-containing phosphatase 1 (SHP1; see the record for spin)
 
Two different ZAP-70 isoforms have been reported in mouse and human. In mice, a truncated ZAP kinase (TZK) lacking both SH2 domains and part of interdomain B has been characterized. TZK retains kinase function in vitro, but is unable to transduce TCR signaling (39). In humans, a truncated ZAP70 transcript is predicted to encode a protein lacking the first N-terminal SH2 domain (40)
 
The murdock mutation results in an isoleucine to phenylalanine substitution within the catalytic kinase domain at amino acid 367. The aberrant protein is normally expressed (1) (Figure 10).
Expression/Localization
Northern blot analysis of ZAP70 mRNA detected expression in all human and murine T cells lines tested. ZAP70 mRNA was also detected in human natural killer (NK) cell lines. Northern blot analysis in tissues detected highest levels in human thymus and lower levels in human spleen and peripheral blood lymphocytes. An analysis of mouse tissues demonstrated a similar tissue distribution with transcripts present predominantly in thymus and at lower levels in lymph node and spleen (5;8). A detailed examination of ZAP-70 expression during mouse T cell development revealed that all major thymocyte populations expressed ZAP-70 protein although CD4- CD8- double negative (DN) T cells expressed lower levels than DP and mature single-positive (SP) T cells in the mouse. In humans, DN and DP thymocytes had lower levels of ZAP-70 protein than did SP T cells (8). Interestingly, Syk and Zap70 mRNA are inversely expressed during T cell development. Syk mRNA is strongly expressed at the DN2 stage when Zap70 is barely detectable and is expressed at lower levels during later development. Zap70 expression is first up-regulated within the DN3 population and increases in later stages, and ZAP-70 protein is first seen at significant levels in DN4 cells (41)
 
Like full-length ZAP-70, the TZK isoform is expressed in mouse thymus, spleen, and lymph nodes. However, a different expression profile is noted for this isoform in T cell subsets relative to ZAP-70. The TZK cDNA is detected in all developing T cell subsets, including the most immature CD44+CD25- thymocytes at the double negative (DN) 1 stage (see Background). Full-length ZAP-70 cDNA is not detected until the DN3 stage in CD44-CD25+ thymocytes (39)
 
ZAP70 mRNA can be strongly expressed in chronic lymphocytic leukemia (CLL) B cells (42), as well as B-cell acute lymphoblastic leukemia (B-ALL) (43;44). Various studies have either detected expression in all human B cell subsets including mature peripheral B cells, but other studies suggest expression may be limited to developing B cells and certain activated human B cell subsets (43;45;46). In mouse, ZAP-70 protein is expressed at relatively low levels in all developing and mature B cell subsets, although expression is slightly higher at the pro-B stage of development (47;48).
 
In resting T cells, ZAP-70 is distributed throughout the cytoplasm, but is rapidly recruited to the plasma membrane following TCR stimulation and ITAM phosphorylation (49;50). The TZK isoform remains cytoplasmic (39).
Background
Figure 10. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.
Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (51;52)] (Figure 10). TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs). Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β for most T cells), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer (53). Signaling by the TCR complex depends on the phosphorylation of ITAMS present on the CD3 and ζ chains [reviewed in (54;55)].  One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex where they phosphorylate ITAMS. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. Syk and ZAP-70 function as critical mediators of pre-TCR and TCR signaling, with ZAP-70 having a predominant role in mature T cells (52;56). The Syk family kinases phosphorylate LAT and SLP-76 (37;38). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. LAT binds to the adaptor proteins growth factor receptor-bound 2 (Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1. SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1). This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways. Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ (PKCθ; please see the record for Untied) and Ras, respectively. PKCθ regulates nuclear factor-κB (NF-κB; see the records for panr2 and xander) activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1 or paracaspase), and caspase recruitment domain family, member 11 (CARMA1 or CARD11; see the record for king). In its GTP-bound active state, Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors [reviewed by (57)].
 
Development of thymocytes into mature T cells occurs in the thymus through a differentiation program characterized by the expression of certain cell-surface markers including CD4, CD8, CD44 and CD25 [reviewed in (52)]. The most immature stage of thymocyte development is known as the double negative (DN) stage due to the lack of expression of the T cell coreceptors CD4 and CD8. Differentiation proceeds through several stages known as DN1-4 that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4). The DN3 stage is the first critical checkpoint during thymocyte development. Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ. This complex is known as the pre-TCR and produces a TCR-like signal that is necessary for continued survival. At this checkpoint, γδ T cells also undergo extensive DNA rearrangements at the γ and δ loci in order to express functional TCR chains. After progressing through the DN4 stage, αβ thymocytes express both CD4 and CD8 and are known as double positive (DP) cells. Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain. The strength of interaction of the final TCRαβ receptor to self-MHC molecules expressed on stromal or APCs in the thymus determines whether or not thymocytes are positively selected and survive to become a single positive (SP) CD4 or CD8 T cell. Strong interactions and increased TCR signaling likely represents autoreactivity and results in negative selection, while moderate interactions indicates usefulness of the TCR and results in positive selection. Cells that are unable to effectively bind MHC are eliminated. By contrast, most γδ T cells remain DN as they mature (58). CD4+ T cells or T helper cells go on to become several distinct subsets of T cells including T helper cell subsets Th1, Th2, Th3, Th17 and follicular helper (TFH) cells (please see the record for sanroque), as well as Tregs. Other T cell types include natural killer T (NKT) cells, which express receptors normally associated with NK cells and can rapidly produce large amounts of cytokines upon stimulation (59).
 
Zap70 knockout mice display an arrest of T cell development at the DP stage, the second critical checkpoint important during αβ T cell development due to defective TCR-mediated selection and signaling at this stage (56;60). ZAP-70 deficient mice retain the presence of γδ T cells in lymph nodes, although dendritic epidermal and intestinal intraepithelial γδ T cells are reduced in number (56). These results suggest that ZAP-70 plays an essential role in αβ T cell development, but is not necessary for the development of some γδ T cell subsets. In addition to mice with complete ZAP-70 deficiency, animals with hypomorphic Zap70 mutations have also been reported. Replacement of the interdomain B tyrosines Tyr 315 and Tyr 319 with phenylalanines in transgenic and knockin mouse models results in a reduction of various signals downstream of the TCR, and mice display impairment of both positive and negative selection during T cell development (22;25). These studies demonstrated a more critical role for Tyr 319 than Tyr 315 in TCR signaling (25). Although mutation of these residues to alanines increased ZAP-70 kinase activity in vitro (34), in mice this also resulted in hypomorphic ZAP-70 function with reduced TCR signaling, impaired T cell development and selection (61). Another hypomorphic mutation includes the spontaneous mutation (W163) of the second SH2 domain found in SKG mice. Interestingly, both the alanine knockin mouse model and the SKG mice display autoimmune phenotypes and develop rheumatoid factor antibodies probably due to defects in negative selection resulting in the selection of autoreactive CD4+ T cells. However, despite defective Treg function, the alanine knockin mouse model does not develop outright autoimmunity, while SKG mice develop arthritis with symptoms very similar to human rheumatoid arthritis (RA; OMIM #180300) (62). Finally, an ENU-generated Zap70 mutation occurring at the C-terminal end of the kinase domain results in increased IgE levels, absence of peripheral T cells and a block in late thymocyte differentiation (63).
 
The phenotype of animals with mutations in Zap70 suggests that ZAP-70 is only required relatively late during T cell development and is not necessary for pre-TCR signaling. This may be due to functional redundancy with Syk. Ectopic expression of Syk during T cell development can reverse the DP block caused by ZAP-70 deficiency (64), and deficiency of both Syk and ZAP-70 results in a complete arrest at the DN stage (65).   Syk-deficient mice have a normal pattern of αβ T cell development, but display impairment of certain γδ lineage T cells in addition to B cell defects (66-68). During the DN3 stage of development, Syk is able to transduce the earliest pre-TCR signal, while ZAP-70 is more important for sustained pre-TCR and TCR signals at the DN4, single-positive and DP stages. Robust up-regulation of ZAP-70 only occurs after DN3 cells have already signaled through the pre-TCR (41). The requirements of pre-TCR and TCR signaling for Syk or ZAP-70 may have something to do with their different kinase efficiencies in vitro (69), different requirements for Src family kinase (SFK) activation (70), and abilities to transduce certain signals downstream of TCR or B cell receptor (BCR) signaling (48;71)
 
Although ZAP-70 has a critical role in T cell development and function, it also plays a role downstream of the BCR and in NK cells. Like T cells, B cells develop through a differentiation program characterized by the expression of certain cell-surface markers and sequential recombination of immunoglobulin gene loci, and pre-BCR and BCR signaling occurs through similar mechanisms used by the pre-TCR and TCR complexes [reviewed in (72;73)]. Zap70 knockout mice display normal B cell development, mount normal antibody responses and also proliferate appropriately to various stimuli (48). However, only mice deficient for both Syk and ZAP-70 show a complete block in B cell development at the pro-B to pre-B transition, the first critical checkpoint during B cell development, rather than the partial block seen in Syk deficient animals (47;66;67). Similar to the role of ZAP-70 in T cell development, Syk is necessary for the second critical checkpoint, the transition from immunoglobin M (IgM) expressing immature cells to mature B cells known as B cell positive selection (66;67;74). ZAP-70 is expressed at slightly higher levels in pro-B cells than in other B cell subsets perhaps explaining why it can partially compensate for the lack of Syk function at this stage, but not during the immature to mature B cell transition. Overexpression of ZAP-70 can rescue positive B cell selection in Syk-deficient mice (48)
 
NK cells are innate immune cells that produce cytokines and eliminate cells that, due to infection or tumor transformation, have inadequate expression of major histocompatibility complex (MHC) class I molecules. These effector functions are regulated by multiple receptor-ligand systems that maintain a balance between the opposing forces of activating and inhibitory signals [reviewed by (75)]. NK cells express the ITAM-bearing CD3ζ, FcεRIγ and DAP12 adaptor proteins, which can initiate TCR and BCR-like signal transduction cascades that involve Syk and ZAP-70 recruitment to the membrane. However, NK cells from mice lacking both Syk and ZAP-70 retain functional activity and can lyse target cells appropriately. At least certain NK-cell functions are dependent on Syk and ZAP-70 as deficiency in these kinases prevents a response to certain activating receptors like CD16 and Ly49D that signal through ITAMs (76). Other NK cell activating receptors such as NKR-P1C (natural killer receptor protein 1C; see the record for Unnatural), may also interact with ITAM-bearing chains and recruit Syk family kinases (77). The lack of aberrant NK cell function in mice deficient for both Syk and ZAP-70 suggests that NK cells can respond to multiple redundant pathways.
 
Several severe combined immunodeficiency patients harbor mutations in the ZAP70 gene (OMIM +176947). Unlike mice with ZAP-70 deficiency that display total lack of of both CD4+ and CD8+ peripheral T cells, immature CD4+CD8+ thymocytes from human patients are able to mature into CD4+ T cells but are unable to form CD8+ T cells in peripheral blood due to a block in positive selection (78-80). These peripheral CD4+ T cells are functionally incompetent to transduce TCR-mediated signals.  The human ZAP70 mutations resulting in SCID are mostly located in the kinase domain of the protein or are mutations causing transcriptional loss or destabilized protein [reviewed by (7)].  One of these patients was found to contain a missense mutation within the highly conserved DLAARN motif, identical to the spontaneous DLAARN mutation reported in mice, but peripheral CD4+ T cells are still observed in the human patient while mutant mice contain no peripheral T cells (20;21). It is possible that in humans Syk may partially compensate for the loss of ZAP-70 function in CD4+ T cell development as Syk levels are present at higher levels and later stages in human thymocytes relative to mouse thymocytes (81). A patient displaying elevated levels of IgE has also been reported (82). Interestingly, aberrant levels of ZAP-70 are thought to contribute to the development of B cell chronic lymphocytic leukemia (CLL), a common lymphoid malignancy characterized by a monoclonal expansion of mature CD5+ B cells (typically B-1 cells) [reviewed by (83)]. Patients with progressive CLL often display higher ZAP-70 expression that correlates with stronger activation of proximal signaling molecules following BCR-engagement (84-86). Recently, high levels of ZAP-70 were found in patients with primary pre-B cell acute lymphoblastic leukemia (ALL), suggesting ZAP-70 may play a role in this malignancy as well (44).
Putative Mechanism
The murdock mutation results in a substitution of an isoleucine for phenylalanine within the kinase domain. As phenylalanine is a bulky residue, the change is predicted to alter the dimensions of the ATP-binding pocket within the catalytic cleft (Figure 8). Although the aberrant protein is normally expressed in mutant thymocytes, it has decreased kinase activity in a cotransfection kinase assay. Nevertheless, the presence of the affected protein in mutant mice apparently leads to some normal functioning downstream of the TCR perhaps due to an ability to recruit the appropriate TCR signaling molecules.
 
The differences in phenotypes between the parental murdock and mrtless mouse strains to Zap70mrd/mrt offspring suggests that different titrations of ZAP-70 are necessary for various TCR-dependent signals. The murdock mutant moderately decreased TCR signaling and thymic selection without compromising immunological tolerance, but the more severe mrtless mutation abolished positive selection leading to immunodeficiency.  In contrast, the generation of compound heterozygous mice led to compromised negative selection of T cells as well as Treg formation, similar to other Zap70 mouse models that cause autoimmune phenotypes (61;62). These animals also displayed increased IgE levels in common with another reported ENU-generated Zap70 mutant (63). The varying phenotypes in different Zap70 mutant mice suggest that quantitative changes in ZAP-70 activity have pleiotropic threshold effects on the immune system. Some T cell responses are quite sensitive to differences in ZAP-70 function including Th1 responses, CD4+ T cell positive selection, peripheral naïve CD4+ T cell numbers and negative selection of certain T cell subsets as they are affected by the mild murdock allele.  By contrast, germinal center memory antibody responses, negative selection of other T cell subsets, regulatory T cell formation and function, and TCR-induced calcium responses were relatively normal Zap70mrd/mrd mice, but affected in compound heterozygotes.  The different threshold for effects on CD44lo and CD44hi subsets of CD4+ and CD8+ T cells is consistent with evidence that these subsets vary in their dependence on TCR signals for persistence   Naïve T cells require both TCR-signaling and the cytokine interleukin 7 (IL-7)  for long-term survival, whereas memory T cells do not seem to be as dependent on TCR-mediated signals as they were able to survive in the absence of MHC molecules or after conditional TCR ablation [reviewed by (87)].  
 
The immune dysregulation seen in mice and humans with diminished (but not absent) TCR signaling is multifactorial and pleiotropic due to varying effects on thymic deletion, Treg formation and function, lymphopenia and immune deficiency. Elevated IgE levels are characteristic of Treg deficiency caused by mouse and human FOXP3 mutations and of hypomorphic mouse and human RAG mutations (88-90), and Zap70mrd/mrt mice display reduced numbers of Tregs that have decreased CD25 expression, an important regulator of antigen receptor signaling. However, the hyper-IgE phenotype in heterozygous compound mice was not suppressed by equal numbers of normal T cells or Tregs suggesting that the defect is caused by a T cell-autonomous defect such as escape from thymic deletion. This result contrasts with the suppression of arthritis in the SKG Zap70 mutant mice following the adoptive transfer of Tregs (91). These differences may be explained by genetic background, the relative levels of TCR signaling in varying mutant mice, and the relative dependence of different T cell subsets on the strength of TCR signaling.
Primers Primers cannot be located by automatic search.
Genotyping

Genotyping protocols are from the Australian PhenomeBank.

Murdoch (MS PCR)
Murdoch (amplifluor)

References
40. Strausberg, R. L., Feingold, E. A., Grouse, L. H., Derge, J. G., Klausner, R. D., Collins, F. S., Wagner, L., Shenmen, C. M., Schuler, G. D., Altschul, S. F., Zeeberg, B., Buetow, K. H., Schaefer, C. F., Bhat, N. K., Hopkins, R. F., Jordan, H., Moore, T., Max, S. I., Wang, J., Hsieh, F., Diatchenko, L., Marusina, K., Farmer, A. A., Rubin, G. M., Hong, L., Stapleton, M., Soares, M. B., Bonaldo, M. F., Casavant, T. L., Scheetz, T. E., Brownstein, M. J., Usdin, T. B., Toshiyuki, S., Carninci, P., Prange, C., Raha, S. S., Loquellano, N. A., Peters, G. J., Abramson, R. D., Mullahy, S. J., Bosak, S. A., McEwan, P. J., McKernan, K. J., Malek, J. A., Gunaratne, P. H., Richards, S., Worley, K. C., Hale, S., Garcia, A. M., Gay, L. J., Hulyk, S. W., Villalon, D. K., Muzny, D. M., Sodergren, E. J., Lu, X., Gibbs, R. A., Fahey, J., Helton, E., Ketteman, M., Madan, A., Rodrigues, S., Sanchez, A., Whiting, M., Madan, A., Young, A. C., Shevchenko, Y., Bouffard, G. G., Blakesley, R. W., Touchman, J. W., Green, E. D., Dickson, M. C., Rodriguez, A. C., Grimwood, J., Schmutz, J., Myers, R. M., Butterfield, Y. S., Krzywinski, M. I., Skalska, U., Smailus, D. E., Schnerch, A., Schein, J. E., Jones, S. J., Marra, M. A., and Mammalian Gene Collection Program Team. (2002) Generation and Initial Analysis of More than 15,000 Full-Length Human and Mouse cDNA Sequences. Proc. Natl. Acad. Sci. U. S. A. 99, 16899-16903.

91. Hirota, K., Hashimoto, M., Yoshitomi, H., Tanaka, S., Nomura, T., Yamaguchi, T., Iwakura, Y., Sakaguchi, N., and Sakaguchi, S. (2007) T Cell Self-Reactivity Forms a Cytokine Milieu for Spontaneous Development of IL-17+ Th Cells that Cause Autoimmune Arthritis. J. Exp. Med. 204, 41-47.

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Lisa A. Miosge, Adele L. Yates, Edyta M. Kucharska, Daniel Sheahan, Tomas Brdicka, Arthur Weiss, Adrian Liston, and Christopher C. Goodnow.
List |< first << previous [record 3 of 7] next >> last >|
Edit History
2011-08-17 10:20 AM (current)
2011-08-16 4:08 PM
2011-03-02 2:38 PM
2011-01-07 2:32 PM
2011-01-06 9:36 AM
2011-01-05 9:08 AM
2011-01-04 2:53 PM
2010-10-28 9:50 AM
2010-07-13 3:08 PM
2010-05-28 7:35 AM
2010-05-26 10:13 AM