Phenotypic Mutation 'wanna' (pdf version)
Allelewanna
Mutation Type missense
Chromosome1
Coordinate36,770,983 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539; Ensembl: ENSMUST00000027291, ENSMUST00000070299

Mapped Yes 
Amino Acid Change Histidine changed to Arginine
Institutional SourceBeutler Lab
Ref Sequences
H58R in Ensembl: ENSMUSP00000027291 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000027291)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells - decreased
FACS CD8+ T cells - decreased
T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance 100% 
Alleles Listed at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository

none

Last Updated 2017-08-08 8:01 PM by Diantha La Vine
Record Created 2010-06-02 4:59 PM by Carrie N. Arnold
Record Posted 2011-01-05
Phenotypic Description

The wanna mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses. Wanna mice lack a T-dependent immuoglobin G (IgG) response to model antigens encoded by a recombinant suicide vector based on the Semliki Forest Virus (rSFV), but display normal T-independent IgM responses to haptenated ficoll and serum levels of IgA. Flow cytometric analysis of peripheral blood lymphocytes from the four original index mice showed a lack of peripheral CD4+ and CD8+ T cells (lower panels in CD4 vs CD8 plots), but had normal frequencies of natural killer (NK) cells (lower panels in CD8 vs NK1.1 plots) and mature B cells (not shown).

 

Nature of Mutation

The wanna mutation was mapped to Chromosome 1 by outcrossing homozygous animals to the closely related C57BL/10J strain and backcrossing F1 animals back to wanna mice. The DNA samples from phenotypically wild type and mutant animals were pooled separately and analyzed by bulk segregation analysis (BSA) using a panel of 124 single nucleotide polymorphisms (SNPs) (1).  Sequencing of the candidate gene Zap70 on Chromosome 1 found an A to G transition at position 264 of the Zap70 transcript using Genbank record NM_009539, in exon 2 of 13 total exons.

 

248 GACGTGCGCTTCCACCATTTCCCCATCGAGCGC
53  -D--V--R--F--H--H--F--P--I--E--R-

 

The mutated nucleotide is indicated in red lettering and causes a histidine to arginine change at amino acid 58 of the encoded protein.

Protein Prediction
Figure 5. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The Wanna mutation causes a histidine to arginine change at amino acid 58. The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Click on the image to view other mutations found in ZAP-70 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The wanna mutation results in a histidine to arginine substitution of a conserved residue in the N-terminal SH2 domain (Figure 5).  Along with the C-terminal SH2 domain, this domain is required to bind to the phosphorylated tyrosines of immunoreceptor tyrosine-based activation motifs (ITAMS) of the ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse).  The N-terminal SH2 domain makes van der Waals contacts with the second phosphorylated tyrosine of an ITAM [(D/E)xxYxxI/Lx(6-8)YxxI/L] according to crystal structure studies (FIgure 6) (2).  The phenotypes of wanna mice provide in vivo confirmation that His 58 is important for ZAP70 function.

 

Please see the record for murdock for more information about Zap70.

Primers Primers cannot be located by automatic search.
Genotyping
Wanna genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
Wanna(F): 5’- ACTGACTCCCGTGCAAAGATGAGG -3’
Wanna(R): 5’- TCAAGCATAGCACATGCTGAGGAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Wanna_seq(F): 5'- ATGATGGCCCTGAAACGC -3'
Wanna_seq(R): 5'- GAGGACTACAGCCTATAGTCTCTG -3'
 
The following sequence of 777 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 1, bases 36,827,587 to 36,828,363) is amplified:
 
 
actgactccc gtgcaaagat gaggcaccat gatggccctg aaacgccttt gcacccacag
ggtccagcga tgcccgatcc cgcggcgcac ctgccattct tctatggcag catctcgcgg
gctgaggccg aggagcacct gaagctggca ggcatggccg acgggctgtt cctcctgcgc
cagtgtttgc gctccctggg cggctacgtg ctgtcgttgg tgcacgacgt gcgcttccac
catttcccca tcgagcgcca actcaacggc acgtacgcca tcgcgggcgg gaaggcgcac
tgcggcccgg ccgagctctg ccagttctac tctcaggacc ccgacgggct gccctgcaac
ctgcgtaagc cgtgtaaccg gccgcccgga ctggagccac agcccggggt cttcgactgc
ctgcgtgatg ctatggtgcg cgactacgtg cgccagacct ggaagctgga ggtgagggcg
tggtcagagg gggagtgggc gaggcatgga ggctgatgct gtgtcttcat tggcttgcaa
gatgctctga ggcctgggat ttggaagtga cagaatgctg aggccctagt tgagcccatg
acctggaagg aggacttgca ggtccaggct tgcgcagcct gaatgatgct gtggtgcttc
accatctatg atgcgcctga aggtgccaga gaggaccatg aagggcaggc ctgtggccta
cagaaggatg gcagacagag actataggct gtagtcctca gcatgtgcta tgcttga

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie Arnold, Elaine Pirie, and Bruce Beutler
Edit History
2011-08-17 10:18 AM (current)
2011-08-16 4:14 PM
2011-08-16 1:36 PM
2011-07-28 7:45 PM
2011-06-15 5:37 PM
2011-02-15 6:12 PM
2011-02-08 3:49 PM
2011-01-07 9:58 AM
2011-01-06 1:50 PM
2011-01-06 1:50 PM
2011-01-06 1:49 PM
2011-01-06 9:54 AM
2011-01-06 9:42 AM
2011-01-05 11:21 AM