Phenotypic Mutation 'nd6'

• Allele: nd6
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 59,549,354 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Nlrp3
• Gene Name: NLR family, pyrin domain containing 3
• Synonym(s): Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
• Chromosomal Location: 59,541,568-59,566,956 bp (+)
• MGI Phenotype: Strain: 3686871; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8R4B8
• SMART Domains: Protein: ENSMUSP00000078440; Gene: ENSMUSG00000032691; AA Change: R586G

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000079476)
• SMART Domains: Protein: ENSMUSP00000098707; Gene: ENSMUSG00000032691; AA Change: R586G

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000101148)
• SMART Domains: Protein: ENSMUSP00000114231; Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.081)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm, gDNA
• Last Updated: 2019-01-29 1:20 PM by Diantha La Vine
• Record Created: 2010-06-05 8:25 PM by Hua Huang
• Record Posted: 2010-10-18
• Science Writers: Nora G. Smart
• Illustrators: Katherine Timer
• Authors: Hua Huang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_145827; MGI: 2653833

Alleles Listed at MGI

All alleles(10) : Targeted, knock-out(3) Targeted, other(4) Chemically induced(3)

Repository

none

Phenotypic Description

Figure 1.

The ND6 phenotype was initially identified among G3 mice (G5801 and G5806) homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU) and tested in the NALP3 Inflammasome Screen.  Peritoneal macrophages isolated from these mice secreted reduced amounts of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).  Macrophages from G5801 produced normal levels of tumor necrosis factor (TNF)-α in response to LPS stimulation alone, suggesting that signaling from the Toll-like receptor 4 (TLR4), which senses LPS, was unimpaired.

Nature of Mutation

The Nlrp3 gene was directly sequenced as a candidate gene and an A to G transition was found at position 1982 of the Nlrp3 transcript in exon 4 of 10 total exons using Genbank record NM_145827. The mutation is located in the third coding exon.

 

1967 CTTGTAAACCAGGAGAGAACCTCTTATTTGGAG

581 -L--V--N--Q--E--R--T--S--Y--L--E-

 

The mutated nucleotide is indicated in red lettering, and causes an arginine to glycine substitution at residue 586 of the NLRP3 protein.

Protein Prediction

Figure 2. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The nd6 mutation causes an arginine to glycine substitution at residue 586. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The ND6 mutation results in an arginine to glycine change in coding exon 3, and occurs in the region between the nucleotide-binding domain (NBD) and the first leucine rich repeat (LRR). 

 

Please see the record for ND1 for more information about Nlrp3.

Putative Mechanism

NLRP3 is able to oligomerize through its NBD domain and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. A large variety of agents have been shown to activate the NLRP3 inflammasome, and NLRP3 plays an important role in the innate immune response.

 

A total of 93 disease-associated mutations have been found in humans in the NLRP3 gene according to the Infevers database, an online database for autoinflammatory mutations (1-3). Rather than causing immunodeficiencies, these are activating mutations that cause autoinflammatory disorders including Muckle-Wells syndrome (MWS; #191900), familial cold autoinflammatory syndrome (FCAS1; OMIM #120100), and chronic infantile neurologic cutaneous and articular syndrome (CINCA; #607115), also known as NOMID for neonatal onset multisystem inflammatory disease (4-6). Collectively, these diseases are known as cryopyrin associated periodic syndrome (CAPS). Interestingly, the vast majority of these activating missense mutations are located in exon 3, which encodes the NBD and surrounding sequences. These mutations are thought to either allow the protein the ability to permanently bind to and hydrolyze ATP or unable to bind to the inhibitory LRRs that prevent self-oligomerization (7-8).  However, the ND6 mutation, which is located in the same exon, appears to be an inactivating mutation and renders macrophages unresponsive to NLRP3-activating stimuli. The mechanism by which the ND6 mutation affects NLRP3 function is unknown. 

Primers

Primers cannot be located by automatic search.

Genotyping

ND6 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

ND6(F): 5’- AGGCTGATCCAAGAGAATGAGGTCC -3’

ND6(R): 5’- AACACACTGAACCTGGTCCAAGGG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

ND6 _seq(F): 5'- ATCTTCTGAACCGAGACGTG -3'

ND6 _seq(R): 5’- AGCGTTTTGACCCTATGACAG -3’

 

The following sequence of 939 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 59,362,277 to 59,363,215) is amplified:

 

aggctgatcc aagagaatga ggtcctcttt accatgtgct tcatccccct ggtctgctgg
attgtgtgca cggggctaaa gcaacagatg gagaccggga agagcctggc ccagacctcc
aagaccacta cggccgtcta cgtcttcttc ctttccagcc tgctgcaatc ccgggggggc
attgaggagc atctcttctc tgactaccta caggggctct gttcactggc tgcggatgga
atttggaacc agaaaatcct atttgaggag tgtgatctgc ggaagcacgg cctgcagaag
actgacgtct ccgctttcct gaggatgaac gtgttccaga aggaagtgga ctgcgagaga
ttctacagct tcagccacat gactttccag gagttcttcg ctgctatgta ctatttgctg
gaagaggagg cagaggggga gaccgtgagg aaaggaccag gaggttgttc agatcttctg
aaccgagacg tgaaggtcct actagaaaat tacggcaagt ttgaaaaagg ctatctgatt
tttgttgtcc gattcctctt tggccttgta aaccaggaga gaacctctta tttggagaag
aaactaagtt gcaagatctc tcagcaagtc agactggaac tactgaagtg gattgaagtg
aaagccaagg ccaagaagct gcagtggcag cccagccaac tggaactgtt ctactgcctg
tacgagatgc aggaggaaga ctttgtgcag agtgccatgg accactttcc caaaattgag
atcaacctct ctaccagaat ggaccacgtg gtttcctcct tttgtattaa gaactgtcat
agggtcaaaa cgctttccct gggttttttt cacaactcgc ccaaggagga agaagaagag
aggagaggag gtcgaccctt ggaccaggtt cagtgtgtt
        

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References

1. Milhavet, F., Cuisset, L., Hoffman, H. M., Slim, R., El-Shanti, H., Aksentijevich, I., Lesage, S., Waterham, H., Wise, C., Sarrauste de Menthiere, C., and Touitou, I. (2008) The Infevers Autoinflammatory Mutation Online Registry: Update with New Genes and Functions. Hum. Mutat. 29, 803-808.

2. Touitou, I., Lesage, S., McDermott, M., Cuisset, L., Hoffman, H., Dode, C., Shoham, N., Aganna, E., Hugot, J. P., Wise, C., Waterham, H., Pugnere, D., Demaille, J., and Sarrauste de Menthiere, C. (2004) Infevers: An Evolving Mutation Database for Auto-Inflammatory Syndromes. Hum. Mutat. 24, 194-198.

3. Sarrauste de Menthiere, C., Terriere, S., Pugnere, D., Ruiz, M., Demaille, J., and Touitou, I. (2003) INFEVERS: The Registry for FMF and Hereditary Inflammatory Disorders Mutations. Nucleic Acids Res. 31, 282-285.

4. Dode, C., Le Du, N., Cuisset, L., Letourneur, F., Berthelot, J. M., Vaudour, G., Meyrier, A., Watts, R. A., Scott, D. G., Nicholls, A., Granel, B., Frances, C., Garcier, F., Edery, P., Boulinguez, S., Domergues, J. P., Delpech, M., and Grateau, G. (2002) New Mutations of CIAS1 that are Responsible for Muckle-Wells Syndrome and Familial Cold Urticaria: A Novel Mutation Underlies both Syndromes. Am. J. Hum. Genet. 70, 1498-1506.

5. Feldmann, J., Prieur, A. M., Quartier, P., Berquin, P., Certain, S., Cortis, E., Teillac-Hamel, D., Fischer, A., and de Saint Basile, G. (2002) Chronic Infantile Neurological Cutaneous and Articular Syndrome is Caused by Mutations in CIAS1, a Gene Highly Expressed in Polymorphonuclear Cells and Chondrocytes. Am. J. Hum. Genet. 71, 198-203.

6. Hoffman, H. M., Rosengren, S., Boyle, D. L., Cho, J. Y., Nayar, J., Mueller, J. L., Anderson, J. P., Wanderer, A. A., and Firestein, G. S. (2004) Prevention of Cold-Associated Acute Inflammation in Familial Cold Autoinflammatory Syndrome by Interleukin-1 Receptor Antagonist. Lancet. 364, 1779-1785.

7. Neven, B., Callebaut, I., Prieur, A. M., Feldmann, J., Bodemer, C., Lepore, L., Derfalvi, B., Benjaponpitak, S., Vesely, R., Sauvain, M. J., Oertle, S., Allen, R., Morgan, G., Borkhardt, A., Hill, C., Gardner-Medwin, J., Fischer, A., and de Saint Basile, G. (2004) Molecular Basis of the Spectral Expression of CIAS1 Mutations Associated with Phagocytic Cell-Mediated Autoinflammatory Disorders CINCA/NOMID, MWS, and FCU. Blood. 103, 2809-2815.

8. Albrecht, M., Domingues, F. S., Schreiber, S., and Lengauer, T. (2003) Structural Localization of Disease-Associated Sequence Variations in the NACHT and LRR Domains of PYPAF1 and NOD2. FEBS Lett. 554, 520-528.