Phenotypic Mutation 'well' (pdf version)
List |< first << previous [record 54 of 132] next >> last >|
Allelewell
Mutation Type nonsense
Chromosome7
Coordinate30,877,787 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Cd22
Gene Name CD22 antigen
Synonym(s) Lyb-8, Lyb8
Chromosomal Location 30,865,402-30,880,342 bp (-)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Accession Number

Genbank: NM_001043317.2, NM_009845.3; Ensembl: ENSMUST00000108125; MGI: 88322

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Q32* in Ensembl: ENSMUSP00000019248 (fasta)
Q31* in Ensembl: ENSMUSP00000019248 (fasta)
Q32* in Ensembl: ENSMUSP00000140521 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(5) Targeted, other(3) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
crullers UTSW 7 30869883 missense probably damaging 1.00
gansu UTSW 7 30870105 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
yosemite UTSW 7 30869509 critical splice donor site probably null
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30869509 critical splice donor site probably null
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 synonymous probably null
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
X0025:Cd22 UTSW 7 30873419 unclassified probably null
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 036109-UCD
Last Updated 2018-07-27 4:22 PM by Diantha La Vine
Record Created 2010-07-07 12:49 PM by Carrie N. Arnold
Record Posted 2011-07-01
Phenotypic Description

The well mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses. The index mouse mounted no detectable T-independent immunoglobin M (IgM) response to haptenated ficoll, but had a normal T-dependent IgG response to model antigens encoded by a recombinant suicide vector based on the Semliki Forest Virus (rSFV; Figure 1). Flow cytometry analysis of blood from this mouse revealed a reduction in peripheral B cells, which have a slight maturation defect.

Nature of Mutation

Figure 2. DNA sequencing trace.

The well mutation was mapped on the basis of anemia by bulk segregation analysis (BSA) of F2 intercross offspring using C57BL/10J as the mapping strain.  The mutation showed strongest linkage with Chromosome 7, and causes a C to T transition at nucleotide 457 of the Cd22 transcript using Genbank record NM_001043317.2 in exon 6 of 17 total exons (Figure 2).  Three transcripts of the Cd22 gene are displayed on Ensembl

442 ACCGTTGACCATCCCCAAACCCTCTTTGCCTGG
27  -T--V--D--H--P--Q--T--L--F--A--W-


The mutated nucleotide is indicated in red lettering, and converts a glutamine at amino acid 32 of the encoded protein to a stop codon.

Protein Prediction
Figure 3. Domain structure of CD22. The well mutation converts a glutamine to a stop codon at amino acid 32 of the encoded protein.

The murine Cd22 gene encodes an 868 amino acid protein, with 62% homology to the human protein, that belongs to the Siglec (sialic acid-binding) family of adhesion molecules (1;2) (Figure 3).  Siglecs are members of the immunoglobulin (Ig) superfamily, which specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates.  They are type 1 transmembrane proteins with a sialic acid-binding N-terminal Ig-like V-type domain, variable numbers of Ig-like C2-type domains, a transmembrane region, and a cytoplasmic tail.  CD22 contains seven immunoglobulin domains in its extracellular region at amino acids 31-147, 156-254, 269-337, 365-424,448-523, 541-599, and 628-687 (2).  X-ray and NMR studies have shown that Ig-like domains form Greek-key β-sandwich structures with the varying types differing in the number of strands in the β-sheets as well as in their sequence patterns.  By convention, the strands are labelled a to g in sequence with the two strands present between the c and d strands in V domains being labelled c' and c″.  One β-sheet consists of strands a, b, e and possibly d while the other contains strands c, f, g and possibly c' and c″.  In addition, the C-terminal ends of strands a and g may form a small stretch of parallel β-sheet, disrupting the original strands and giving rise to strands a' and/or g' (3).  Ig-like domains are classified into V-type having all strands, C-type (for the C1-set) lacking the c' and c″ strands, S-type (for the C2-set) having the c' strand but not the c″ or d strands and the H-type, which lacks the c″ strand.  Ig-like domains usually contain a structural motif composed of cysteine residues generally located in the b and f strands that form a disulfide bridge, and a tryptophan residue located in the c strand (4).

The distal V-type domain at amino acids 31-147 is the ligand-binding region of CD22 and binds to N-acetylneuraminic acid (Neu5Ac) or N-glycolylneuraminic acid (Neu5Gc), both in α2,6 linkages to galactose (Neu5Ac-α2,6Gal or Neu5Gc-α2,6Gal) (5-10).  Mouse CD22 strongly prefers Neu5Gc, while human CD22 binds equally to both despite the lack of Neu5Gc specifically in human cells (11;12).  Two arginine residues (Arg130 and Arg137 in mouse) are required for sialic acid-binding, and mutation of these and other residues (Leu61, Val66, Lys73, Gly128, Thr132, Glu136, Trp138, Glu140) within the the gfcc’c”  β-sheet completely abrogates this interaction (12).  CD22-ligand interaction is regulated by the activity of a β-galactoside α2, 6-sialyltransferase that can inactivate CD22-mediated binding by sialylating the CD22 receptor itself, suggesting that N-linked glycosylation sites on the CD22 molecule may play a role in the regulation of CD22-mediated adhesion (13).  Mutagenesis of potential CD22 N-linked glycosylation sites showed that mutation of a single such site in the V-type domain (amino acids 111-113) completely abolished ligand recognition.  This site is characterized by the sequence NCT, where the cysteine is thought to be involved in the intrachain disulfide bond (14).  Potential CD22 ligands include α2,6-sialylated CD45 on T cells, both cell surface and soluble IgM, and haptoglobin (8;15-19).  However, mutating the ligand-binding domain of CD22 did not affect its association with these proteins (20).

The transmembrane domain of murine CD22 occurs at amino acids 709-726.  This is followed by an intracellular tail containing six tyrosine residues.  Three of these tyrosines (Tyr783, Tyr843, and Tyr863) exist in canonical immunoreceptor tyrosine-based inhibitory motif (ITIM) consensus sequences (ILV)xYxx(LV), one tyrosine (Tyr817) is in an ITIM-like sequence VxYxxI, while Tyr828 belongs to a growth factor receptor-bound (Grb) 2 binding consensus site (YxN) (1;2).  After phosphorylation by the non-receptor tyrosine kinase Lyn (21;22), the ITIM and ITIM-like tyrosines are able to interact with the Src-homology 2 (SH2) domain-containing tyrosine phosphatase, SHP1 via its SH2 domain (see the record for spin) (23-28).  Both CD22 and SHP1 can associate with plasma membrane Ca2+-ATPase (PMCA) 4, resulting in enhanced PMCA4-mediated Ca2+ efflux (29).  Phosphorylated CD22 recruits a number of other SH2 domain-containing proteins involved in B cell signaling including spleen tyrosine kinase (Syk), phospholipase C γ2 (PLC-γ2; see the record for queen), phosphatidylinositol 3 kinase (PI3K), and the SLAM-associated protein (SAP) (25;30-33).  The SH2 domain-containing inositol phosphatase SHIP-1 (see the record for styx)) is also recruited, although it is unable to bind directly to phosphorylated CD22 and requires the presence of the adaptor proteins Src homologous and collagen (Shc) and Grb2 (34).  Current evidence suggests that Syk is able to interact with multiple phosphorylated CD22 tyrosines, while the Grb2 complex binds exclusively to Tyr828 and PLC-γ2 and PI3K directly bind Tyr863 (31).

In addition to the above molecules, CD22 is reported to interact with the AP50 subunit of the clathrin-coated pit adapter complex AP2 (35-37).  Interaction of CD22 with AP50 occurs at Tyr843 or Tyr863 via YxxΦ (where Φ is a hydrophobic residue) sorting motifs contained within its ITIM sequences (36).  This interaction is inhibited by tyrosine phosphorylation, thus occurring in a reciprocal fashion to SHP1 binding (31).   CD22 also contains an internalization motif  (QRRWKRTQSQQ in human; QKKWKQNRSQQ in the mouse) located in the cytoplasmic tail, proximal to the plasma membrane.  This polar region is predicted to form a coil or turn structure.  Mutational analysis showed that the the two glutamine residues sandwiching the serine residue are critical to internalization, but that the serine itself is not (38).

Human CD22 is expressed as two differentially spliced forms, one with a five Ig domain extracellular region known as CD22-α and the other more commonly expressed CD22-β form with seven Ig domains.  CD22-α lacks the third and fourth Ig-like domain (1;39).  

The well mutation results in the conversion of a glutamine to a stop codon in the second amino acid of the N-terminal Ig-like V-type domain.  This would truncate most of the CD22 protein and likely results in nonsense-mediated protein degradation.

Expression/Localization

Human CD22 is expressed in the cytoplasm of B cell receptor (BCR)-negative pro- and pre-B cells and on the cell surface of mature B cells after acquisition of IgM.  Once expressed as a membrane protein, CD22 persists on human B cells until they differentiate into plasma cells (40).

According to one report, murine CD22 is also absent on the surface of pro-B cells, pre-B cells and immature IgM-expressing B cells.  Expression increases as IgM+ cells mature and CD22 is expressed at mature levels on all B cell subsets including follicular, marginal zone (MZ), B1 and B cells that have switched their Ig class (41).  According to another study, however, surface expression of CD22 was also observed in B cell progenitors, starting at the pre-B cell stage with the level of CD22 expression increasing with the maturation stage of the developing B cells.  Fetal liver B cell progenitors also increased expression of CD22 during differentiation into mature B cells.  Like the other study, high expression was observed on both follicular and MZB cells in the spleen.  However, low expression was seen on germinal center B cells and was absent on plasmablasts and terminally differentiated and activated plasma cells (42).

Although CD22 is known as a B cell-specific marker, it is expressed at low, but functionally significant, levels on mouse T cells (43).  CD22 exists primarily as homo-multimeric complexes on the surface of B cells in clathrin-coated pit microdomains (44), and the levels of surface CD22 are regulated by clathrin-dependent endocytosis, which is dependent on its association with the AP2 clathrin adaptor (35-37).  Rapid internalization of CD22 depends on its internalization motif (38).

Background

CD22 is one of two Siglecs expressed by B cells (the other being Siglec-G), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed by (45;46)].  Siglecs can be divided into two groups.  The first group includes Siglecs that are well conserved in mammals and consist of sialoadhesin (Siglec-1), CD22 (Siglec-2), myelin-associated glycoprotein (MAG; Siglec-4)  and Siglec-15.  CD33-related Siglecs are a rapidly evolving subset consisting of 10 members in humans, among them Siglec-10/Siglec-G, but just five members in the mouse.  With the exception of MAG, which is found on glia cells of the nervous system, all Siglecs are expressed on cells of the immune system.  Most of these molecules are negative immunoregulators carrying ITIMs that are phosphorylated on tyrosines by Src family kinases, creating binding sites for several SH2  domain-containing signaling molecules.  The most important of these are SHP1 and SHP2, which are known to be recruited to many ITIM-containing receptors leading to dephosphorylation of intracellular substrates and inhibition of several signaling pathways.  ITIM-carrying Siglecs are typically coreceptors that inhibit associated activating receptors that contain immunoreceptor tyrosine-based activation motifs (ITAMs).  Some CD33-related Siglecs lack ITIMs but have charged amino acid residues in their transmembrane domain and can associate with DAP12 (12 kDa DNAX-activating protein), an ITAM-containing adapter that triggers both activating and inhibitory signaling [reviewed by (47)].  Siglecs without ITIMs can also play a role as positive regulators of the immune system (48).

Despite the presence of functional CD22 in T cells (43), CD22 has been primarily characterized as a B cell-specific molecule with expression increasing during B cell maturation (42).  Progenitor pro-B cells give rise to three major populations (49).  Marginal zone (MZ) B cells localize to the splenic marginal zone and respond to blood-borne antigens independently of T cell help (50).  Follicular B cells, by contrast, respond to protein antigens in a T cell-dependent manner, and progressively undergo immunoglobulin isotype switching and affinity maturation.  B-1 B cells comprise a much smaller population, which predominates in the pleural and peritoneal cavities and contributes most of the serum IgM during the early phases of infection (51).  Whereas MZ and B-1 B cells are predominantly self-renewing, follicular B cells require constant replenishment from bone marrow.  The development of B cells in the bone marrow is characterized by the differential expression of marker proteins such as CD45 (B220) (see the record for belittle), and by the sequential recombination of the immunoglobulin gene loci mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive) to form pre-BCR and BCR complexes important for B cell differentiation and activation [reviewed in (52;53)].  

The BCR is a multi-subunit complex that is composed of a membrane-bound Ig molecule that binds foreign particles, and the signal transducing ITAM-carrying Igα (CD79a)/Igβ (CD79b) heterodimer.  Following aggregation and localization of BCR molecules into membrane rafts, Igα and Igβ and the co-receptor CD19 become phosphorylated by the Src family kinases Lyn and Fyn, resulting in recruitment and phosphorylation of Syk (53;54).  Syk phosphorylates a number of targets including the adaptor protein BLNK/SLP65 (see the record for busy), PLC-γ2 and protein kinase C β (PKCβ; see the record for Untied).  BCR stimulation also activates PI3K resulting in the generation of phosphatidylinositol (3,4,5)-trisphosphate (PIP3), which recruits both PLC-γ2 and Bruton’s tyrosine kinase (Btk) to the membrane.  PLC-γ2 then hydrolyzes phosphatidylinositol 4,5 bisphosphate (PIP2) to generate two second messengers, diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP3), which initiate downstream signal transduction pathways involving Ca2+ and PKCβ, respectively.  The recruitment of the guanine nucleotide exchange factors Vav1-3, Nck (non-catalytic region of tyrosine kinase adaptor protein) and Ras by BLNK to the BCR activates MAP kinase cascades such as c-Jun N-terminal kinase (JNK), p38 and extracellular signal regulated kinase (ERK) [reviewed by (55)].  Other adaptor proteins, Swiprosin-1/EFhd2 (Swip-1) and B cell adaptor for PI3K (BCAP), are also important in stabilizing the interactions of molecules within the BCR signalosome (56;57).  Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB (see the records for xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies [reviewed by (53)].  Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1 or paracaspase), and caspase recruitment domain family, member 11 (CARMA1 or CARD11; see the record for king), which are involved in NF-κB activation along with PKCβ (58-63).
 

Figure 4. BCR signaling is regulated by Siglecs CD22 and Siglec-G. Following aggregation and localization of BCR molecules, the cytoplasmic tails of CD22 is phosphorylated by Lyn which recruits SHP-1. The association of Lyn with SHP-1 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca2+ mobilization such as Vav-1, CD19 and BLNK. The mechanism by which Siglec-G functions as an inhibitory receptor is unknown. The ITIMs of Siglec-G/ are phosphorylated by Src family kinases, creating binding sites for several SH2 domain-containing signaling molecules (e.g., SHP1 [see the record for spin] and SHP2). PMCA4 is activated by CD22 and promotes Ca2+ efflux further attenuating the BCR signaling. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

As mentioned above (Protein Prediction), CD22 associates with a number of BCR signaling molecules including the BCR complex itself.  Upon cross-linking of the BCR by antigen, associated CD22 is rapidly phosphorylated by Lyn (17;21;22;64) (Figure 4).  The subsequent association of SHP1 with CD22 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca2+ mobilization such as Vav-1, CD19 and BLNK (65-67).  Another target of SHP1 is PMCA4, which is activated by CD22 and promotes Ca2+ efflux further attenuating the BCR signal (29).  The roles of other CD22-recruited molecules are less clear.  SHIP-1 is also a negative regulator of Ca2+ signaling, but the inhibition of Ca2+ signaling by CD22 appears to be mediated by SHP1 and not by SHIP-1 (29).  The other molecules, including Syk, PLC-γ2, and PI3K, are positive effectors B cell activation and loss of recruitment of these factors may contribute to the reduced anti-IgM triggered proliferation observed in CD22-deficient B cells (68-71).  In the absence of BCR ligation, CD22 cross-linking results in JNK signaling and proliferation of human tonsillar B cells (32;72).  Finally, CD22 can serve as a B-cell stimulatory molecule when aggregated by anti-CD22 antibodies that sequester it from the BCR thus relieving BCR inhibition (23).  

The generation of multiple CD22-deficient mouse lines has confirmed the role of CD22 as an inhibitory coreceptor (68-71).  CD22-deficient B cells derived from these animals display Ca2+ mobilization in response to BCR stimulation, and a longer lasting intracellular Ca2+ signal due to the decrease in PMCA4 activation (29).  In addition, basal chronic activation of CD22-deficient B cells in vivo is suggested by increased major histocompatibility complex (MHC) class II levels, a known activation marker of B cells (68-71).  In response to BCR stimulation, CD22-deficient B cells predominantly undergo apoptosis (73).  Although CD22 appears to be dispensable for the differentiation of B cells to mature follicular cells, CD22-deficient B cells express less surface IgM, which may be a consequence of a faster and more complete maturation process.  In addition, CD22-deficient mice have severely reduced numbers of MZB cells, and increased numbers of B-1 peritoneal cells was observed in two of the four knockout strains (68-71).  Due to the lack of MZB cells, these animals display impaired immune responses to T-independent antigens (68;71;74), while T-dependent immune responses remain intact and subsequent germinal center formation occurs normally (73).  The loss of MZB cells and increased B-1 cell numbers in these mice may be due to altered BCR signaling during development as maturation into the three mature B cell subsets is driven in part by differences in BCR signal strength, and a strong BCR signal disrupts MZB development and promotes B-1 differentiation [reviewed by (75;76)].  Alternatively, ligand binding by CD22 may be required for homing or retention of the MZB cells in the spleen (73;77-79).  Similarly, CD22 is required for the homing or retention of recirculating follicular B cells to the bone marrow by interacting with ligands expressing α2,6-sialic acid on bone marrow epithelium (71;80).  The role of CD22 ligand-binding is discussed in more detail below.   

Potential CD22 ligands carrying α2,6-linked sialic acids are abundantly expressed on the surface of many cells, including erythrocytes, monocytes, cytokine-activated endothelial cells, T cells and B cells (19;81;82), suggesting that CD22 may regulate the activity of some or all of these cell types.  The role of CD22 ligand-binding has been clarified by studying B cell lines and mice carrying mutant forms of CD22 lacking sialic acid binding activity or deficient in sialyl transferases and sialidases that regulate the sialic acid content of membrane glycoproteins (73;77-79;83).  Studies of  CD22 ligand-binding in vitro suggested that interaction with these ligands in cis on the B cell surface regulates the association of CD22 with the BCR and modulates the inhibitory function of CD22 (83;84), while the interaction of CD22 to ligands in trans on the surface of other cells may regulate the BCR signaling threshold (85).  However, CD22 knockin mice carrying ligand-binding deficient CD22 showed normal CD22 tyrosine phosphorylation and Ca2+ signaling (73).  Additionally, mice lacking ST6Gal I sialyltransferase (ST6Gal I), the enzyme responsible for producing the α2,6-sialic acid terminus on N (and some O) glycans, displayed a reduced rather than an increased BCR-induced Ca2+ response that could be due to increased association of CD22 with surface IgM in the absence of ligand resulting in increased IgM endocytosis from clathrin-coated microdomains (77;78;86).  Otherwise, CD22 knockin animals display an almost identical phenotype to CD22 knockout mice including upregulation of MHC class II molecules, enhanced B-cell turnover, reduction of recirculating B cells in the bone marrow, reduction of MZB cells, and reduced anti-IgM-induced proliferation, suggesting that these phenotypes are dependent on the ability of CD22 to bind ligands (73).  ST6Gal I knockout animals also display reduced MZB cell numbers and recirculating B cells in the bone marrow (77;78).  Interestingly, studies of CD22-deficient and ST6Gal I knockout mice suggest that CD22 may be able to bind to ligands other than those expressing α2,6-sialic acid.  A ST6Gal I-independent CD22 ligand was reported to be expressed on dendritic cells and shown to be important for interactions between B cells and dendritic cells (87).  Due to the relatively high concentration of  α2,6-linked sialic acids on the B cell surface, CD22 mostly binds to glycoproteins on the same cell and is unable to interact with exogenously added ligands (88;89).  In some circumstances, CD22 becomes or is more available for binding to ligands in trans, as on MZB cells, transitional B cells and upon cellular activation (89;90).  

Two further enzymes involved in the modification of sialic acids have been deleted in mice.  As mentioned above (Protein Prediction), murine CD22 favors binding to Neu5Gc over Neu5Ac.  Deletion of the CMP-Neu5Ac hydroxylase (Cmah), which modifies Neu5Ac to Neu5Gc and is absent in human cells (11;12), results in higher B cell proliferative and Ca2+ responses, suggesting impaired CD22 function (91;92).  Mice with a deletion of sialate:O-acetyl esterase (Siae), an enzyme that specifically removes acetyl moieties from the 9-OH position of α2-6-linked sialic acid, exhibit very similar phenotypes to CD22-deficient animals including enhanced BCR activation, defects in peripheral B cell development, lower MZB cell numbers and a loss of recirculating B cells in the bone marrow (92).  O-acetylation at this position of  α2-6-linked sialic acids impairs CD22 binding in vitro (93).

B cells have long been considered to have a key role in the development and maintenance of many autoimmune diseases through production of pathogenic autoantibodies, and the hyperactivation seen in CD22-deficient B cells may contribute to the development of autoimmunity.  Mice deficient in either Lyn or SHP1, both of which are important in CD22 signaling, spontaneously develop autoimmunity along with increased B-1 cell numbers, which are implicated in the pathogenesis of several autoimmune diseases (94-96).  In addition, overexpression of the activating coreceptor CD19 results in stronger BCR signaling and increased B-1 cell numbers (97), and Siae-deficient mice spontaneously develop antichromatin autoantibodies and glomerular immune complex deposits (92).  As discussed above, CD22 deficiency may lead to increased B-1 cell numbers and one CD22-deficient mouse line has been reported to display increased autoantibodies (68-70).  However, Siglec-G rather than CD22 appears to be the main inhibitory receptor regulating B-1 development and function in mice (98).  Neither CD22-deficient, nor Siglec-G-deficient mice on a pure C57BL/6 or BALB/c background, respectively, develop autoimmunity.  However, double deficiency of these molecules in mice results in an even larger number of B-1 cells and the development of a moderate form of immune complex glomerulonephritis in aged animals (99).  In addition, several autoimmune-prone strains of mice have Cd22 polymorphisms (Cd22a and the closely related Cd22c), which may contribute to the severity of disease .  The Cd22b form is found in non-autoimmune-prone strains (100;101).  Relative to CD22b, the CD22a protein carries a six amino-acid deletion and several point mutations in the ligand binding domain in an area distinct from the ligand-binding pocket.  These alterations delete an N-linked glycosylation site, which may adversely affect homodimerization (101).  The Cd22a gene also contains a short interspersed nucleotide element insertion in the second intron resulting in abnormal processing of the Cd22 mRNA and production of transcripts containing premature stop codons, as well as aberrant CD22 molecules with reduced ligand-binding abilities (102;103).

In humans, a similar link between CD22 polymorphisms and systemic autoimmunity has not been discovered.  An early study suggested an association of a human CD22 polymorphism with the development of systemic lupus erythematosus (SLE; OMIM #152700), a systemic autoimmune disorder that affects multiple organs, and is characterized by a large scale defect in immune tolerance and development of autoantibodies against multiple antigens (104), but genome-wide association studies did not identify CD22 as an SLE susceptibility locus (105;106).  Another CD22 polymorphism is associated with susceptibility to limited cutaneous systemic sclerosis (107).  However, CD22 has been identified as a useful target for B cell therapies in humans, and anti-CD22 antibodies, immunotoxins and anti-CD22-coupled RNAses have been developed as a treatment for SLE and B cell malignancies such as non-Hodgkin’s lymphoma (OMIM #605027) (108-111).

Putative Mechanism

Due to the premature stop codon introduced by the well mutation near the beginning of the Cd22 transcript, the well allele is likely to be null.  Accordingly, mice carrying this allele are a phenocopy of CD22 knockout mice, displaying defects in peripheral B cell maturation and an absence of T-independent antibody responses that are likely caused by reduced MZB cell numbers.  Like CD22 knockout mice, well animals display relatively normal T-dependent antibody responses (68-71).

Primers Primers cannot be located by automatic search.
Genotyping
Well genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers
Well (F): 5’- CAACCCCAGATTCCCACTGTCATTG -3’
Well (R): 5’- AGAGATTCTGTGCTCCTGCTCCAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Well _seq(F): 5'- CCTTGCTTAGAAAGGTACAGCTC -3'
Well _seq(R): 5’- ACCGTGTGTCTCCCCAG -3’
 
The following sequence of 463 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7, bases 31,662,513 to 31,662,975) is amplified:
 
agagattctg tgctcctgct ccaccgtgtg tctccccagt gtctccctct cctacttcca
gtggaagttc tcacccctca gtaacaactt ctgaccagag ttgtggcctt taggacacgt
ggcttcggct cggtacagct cagcaaatga ttggaccgtt gaccatcccc aaaccctctt
tgcctgggag ggagcctgca tcaggattcc ttgcaagtac aaaactccac tacccaaggc
acgtctggac aacatcctcc tttttcagaa ctatgagttt gacaaggcca ccaagaaatt
cacaggaact gtcctgtaca acgccacaaa gactgagaag gacccagagt ctgagctgta
cctttctaag caagggagag taacatttct ggggaacaga atagacaatt gtaccctgaa
aatccacccg atacgtgcca atgacagtgg gaatctgggg ttg
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is indicated in red.
References

 

 

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Elaine Pirie, and Bruce Beuter
List |< first << previous [record 54 of 132] next >> last >|
Edit History
2011-08-14 10:51 AM (current)
2011-07-15 10:28 AM
2011-07-11 9:24 AM
2011-07-11 9:23 AM
2011-07-11 9:10 AM
2011-07-11 9:10 AM
2011-07-11 9:02 AM
2011-07-05 1:25 PM
2011-07-05 1:24 PM
2011-07-05 9:27 AM
2011-07-05 9:26 AM
2011-07-01 10:37 AM