Phenotypic Mutation 'nd7' (pdf version)
Allelend7
Mutation Type missense
Chromosome11
Coordinate59,555,875 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Nlrp3
Gene Name NLR family, pyrin domain containing 3
Synonym(s) Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
Chromosomal Location 59,541,568-59,566,956 bp (+)
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_145827; MGI: 2653833

MappedYes 
Amino Acid Change Cysteine changed to Arginine
Institutional SourceBeutler Lab
Gene Model not available
AlphaFold Q8R4B8
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: C816R

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
(Using ENSMUST00000079476)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: C816R

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
(Using ENSMUST00000101148)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.081) question?
Phenotypic Category Autosomal Semidominant
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(10) : Targeted, knock-out(3) Targeted, other(4) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Flogiston UTSW 11 59558448 missense probably benign 0.00
nd1 UTSW 11 59565974 missense probably benign 0.45
Nd14 UTSW 11 59555875 missense possibly damaging 0.89
Nd3 UTSW 11 59565974 missense probably benign 0.45
nd5 UTSW 11 59565879 missense probably benign 0.01
nd6 UTSW 11 59549354 missense probably damaging 1.00
Nd9 UTSW 11 59549354 missense probably damaging 1.00
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59548446 missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59548086 missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59565066 missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59543003 splice site probably null
R7916:Nlrp3 UTSW 11 59551863 missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59548788 missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59549403 missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59551790 missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59549271 missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59549390 missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59565044 missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59548758 missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59543315 missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59549322 missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59558552 frame shift probably null
RF040:Nlrp3 UTSW 11 59558552 frame shift probably null
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Mode of Inheritance Autosomal Semidominant
Local Stock None
Repository
Last Updated 2019-01-29 1:21 PM by Diantha La Vine
Record Created 2010-07-14 10:42 AM by Hua Huang
Record Posted 2011-05-23
Phenotypic Description
Figure 1.

The ND7 phenotype was identified in two female sibling G3 mice (H8716 and H8718) tested in the NALP3 Inflammasome Screen.  Peritoneal macrophages isolated from these mice secreted reduced amounts of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).  Macrophages from both mice produced normal levels of tumor necrosis factor (TNF)-α in response to LPS stimulation alone, suggesting that signaling from the Toll-like receptor 4 (TLR4), which senses LPS, was unimpaired.

Nature of Mutation

The Nlrp3 gene was directly sequenced as a candidate gene from the genomic DNA (gDNA) of the index mouse, H8716. A heterozygous T to C transition was found at position 2672 of the Nlrp3 transcript in exon 6 of 10 total exons using Genbank record NM_145827. The mutation is located in the fifth coding exon.  The gDNA of the same index mouse was submitted for whole-genome sequencing using the SOLiD technique, which also identified the same mutation.

2657 GGAATCAGATTGCTGTGTGTGGGACTGAAGCAC
811  -G--I--R--L--L--C--V--G--L--K--H-
 
The mutated nucleotide is indicated in red lettering, and causes a cysteine to arginine substitution at residue 816 of the NLRP3 protein.
Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 2. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The nd7 mutation causes a cysteine to arginine substitution at residue 816. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The ND7 mutation results in a cysteine to arginine change in coding exon 5. The altered amino acid is located in the third leucine rich repeat (LRR) (Figure 2). It is likely that this mutation affects the structure and function of the LRR domain, perhaps interfering with binding to factors that stimulate the inflammasome.

Please see the record for ND1 for more information about Nlrp3.
Primers Primers cannot be located by automatic search.
Genotyping
ND7 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
ND7(F): 5’- ATGGTCGGGGAGTCTATGCACATC -3’
ND7(R): 5’- AGAAGCGTTCAGTAAGGACCCCAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
ND7 _seq(F): 5'- GTCTATGCACATCATGAGGCTAAG -3'
ND7 _seq(R): 5’- ACCATGATGCTTAGCAGTGC -3’
 
The following sequence of 948 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 59,368,891 to 59,379,774) is amplified:
 
                                                                               
atggtcgggg agtctatgca catcatgagg ctaaggaaca aaggaggaag agagcaagag
tgagggggaa agagacagac acacagacac acatacagac agagacagag agacagagag
agacagagac agacagagag acagagagag atagagagag acaaaacagt atttcagtat
ctccctaagg tcaccccctt cagtgtccat acatcccatg tgtcttcctc taggctccac
ttcccagagg tttcagtccc cgccccccat agtgtgagcg tgtaggcgtg ggacacgcat
aggatctgga tcctgagaga ggcctctctc tgatgtctga ttctgttctc gctgtgaagg
ttggggcgct gcggactgtc ccatcaatgc tgcttcgaca tctcctctgt cctgagcagc
agccagaagc tggtggagct ggacctcagt gacaatgccc tgggggactt tggaatcaga
ttgctgtgtg tgggactgaa gcacctgctc tgcaacctcc agaaactgtg gtgagtctgg
cctacctccc ttaggcagct ctgctgtgga ggcccaattc aggaactctg cttcagggag
acacagcgag ccatcatcag ctcctgtgtg aggatgagaa tattctcagc ggcctggagg
gcttcctgcg ctcccttctg ctagtttgcc agtcgttcag tcagccagtg attgctgtgc
ggggagttaa tgggaaaata tagcagtggt gtgtatgtct gtgcgtgtgt gtatgtttat
aaatcatcaa ataaactgtc tttaagatat ccgaggaaac agaagcactg ctaagcatca
tggtagaacg gttttgagag gtcataataa atcctcacac taaatagaaa aaaagcagcg
cttaagcaat ggaatattta ttgtgtgggg tccttactga acgcttct
       
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
Science Writers Nora G. Smart
Illustrators Katherine Timer
AuthorsHua Huang,Bruce Beutler
Edit History
2011-09-01 5:17 PM (current)
2011-09-01 2:15 PM
2011-05-25 10:50 AM
2011-05-24 11:24 AM
2011-05-24 11:23 AM
2011-05-24 11:22 AM
2011-05-23 4:13 PM
2011-05-23 11:41 AM
2011-05-23 10:33 AM
2011-05-23 10:20 AM