Phenotypic Mutation 'dew'

• Allele: dew
• Mutation Type: nonsense
• Chromosome: 11
• Coordinate: 34,248,636 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Dock2
• Gene Name: dedicator of cyto-kinesis 2
• Synonym(s): CED-5, MBC, Hch
• Chromosomal Location: 34,226,815-34,783,892 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016] ; PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8C3J5
• SMART Domains: Protein: ENSMUSP00000090884; Gene: ENSMUSG00000020143; AA Change: Q1439*

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	2e-113	PFAM
Pfam:DOCK-C2	419	616	1e-60	PFAM
Pfam:DHR-2	1114	1614	6.3e-96	PFAM
low complexity region	1691	1706	N/A	INTRINSIC
low complexity region	1793	1800	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm
• MMRRC Submission: 036803-MU
• Last Updated: 2019-05-21 7:40 PM by Diantha La Vine
• Record Created: 2010-10-11 7:39 PM by Carrie N. Arnold
• Record Posted: 2013-01-29
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Carrie Arnold, Elaine Pirie, Ming Zeng and Bruce Beutler

Accession Number

NCBI RefSeq: NM_033374; MGI: 2149010

Alleles Listed at MGI

All alleles(18) : Targeted(4) Gene trapped(11) Spontaneous(1) Chemically induced(2)

Phenotypic Description

Figure 1. The dew mouse was identified in a T-dependent Humoral Response Screen of N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice (red dots).

Figure 2. The dew mice (V7590, V7597, V7592, and V7594) do not exhibit a T-dependent IgG response.

Figure 3. CD4 + and CD8 + T cells are depleted in the dew mice (green bars). Other hematopoietic cell types are not significantly affected.

The dew mutation was identified in a T-dependent Humoral Response Screen of N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice (Figure 1).  The dew mice lack a T-dependent IgG response (Figure 2); the T-independent IgM response is normal. Fluorescence activated cell sorting (FACS) analysis determined that CD4⁺ and CD8⁺ T cells are depleted in the dew mice (Figure 3). 

Nature of Mutation

Whole genome sequencing of a homozygous dew mouse using the SOLiD technique identified a C to T transition at base pair 34148636 on Chromosome 11 in the GenBank genomic region NC_000077 encoding Dock2. The mutation corresponds to residue 4367 of the mRNA sequence NM_033374 in exon 43 (of 52).

 

4380 ACAAGTCTAATTATGTGCAAAAGTTCCACTACTCC

1433 Y--K--S--N--Y--V--Q--K--F--H--Y--S-

 

The mutated nucleotide is indicated in red lettering and results in substitution of glutamine (Q) 1439 for a premature stop codon.

Protein Prediction

Figure 5. Domain structure of mouse DOCK2, a member of the DOCK A subfamily. DOCK A proteins contain an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The dew mutation results in substitution of glutamine (Q) 1439 for a premature stop codon. This image is interactive. Other mutations found in DOCK2 are noted in red. Click on each mutation for more specific information.

The dew mutation results in a coding of a premature stop codon at amino acid 1439 within the catalytic DOCK homology region 2 (DHR-2), a domain essential for the interaction of Dock2 with GTPases [Figure 5; (1;2)].

 

For more information on Dock2, see the record for frazz.

Primers

Primers cannot be located by automatic search.

Genotyping

Figure. DNA sequencing trace of the Chr. + strand.

Dew genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

Dew(F): 5’- AGAAGACCCAGTAGACTTGTCACCC -3’

Dew(R): 5’- AATGCCAGAATTGCAAATGCCCAG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

Dew_seq(F): 5'- AGTAGACTTGTCACCCTATCTGG -3'

 

The following sequence of 415 nucleotides is amplified (Chr. 11: 34248432-34248846, GRCm38.; NC_000077):

 

agaagaccca gtagacttgt caccctatct gggatgtcca tgtagtattc actccctggc
tctggatcaa gctgccccca cctgtggttg gcagaggtgt gttctggttg ctgaagatgg
ctgaggaggg gattatactc acagcaaact cgttctctgg gtctaccttg cccctgcgca
caggcctgga gtagtggaac ttttgcacat aattagactt gtaaaagctg aaagacagaa
aggagtagaa gtttctggaa gccatgctac ccatccactg aaaccttaaa catcaggtct
ggcagggccc tggcagtggc atttcaaggt ctgagttggg gcttcataaa aagtgatttg
cacagggttg cagggtgatt tagaagccac cctgggcatt tgcaattctg gcatt

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated nucleotide is indicated in red (G>A on Chr. + strand; C>T on sense strand).

References

  1. Brugnera, E., Haney, L., Grimsley, C., Lu, M., Walk, S. F., Tosello-Trampont, A. C., Macara, I. G., Madhani, H., Fink, G. R., and Ravichandran, K. S. (2002) Unconventional Rac-GEF Activity is Mediated through the Dock180-ELMO Complex. Nat Cell Biol. 4, 574-582.

  2. Cote, J. F., and Vuori, K. (2007) GEF what? Dock180 and Related Proteins Help Rac to Polarize Cells in New Ways. Trends Cell Biol. 17, 383-393.