Phenotypic Mutation 'seshat' (pdf version)
Alleleseshat
Mutation Type missense
Chromosome6
Coordinate124,872,977 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Cd4
Gene Name CD4 antigen
Synonym(s) L3T4, Ly-4
Chromosomal Location 124,864,692-124,888,221 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013488; MGI: 88335 

MappedYes 
Amino Acid Change Valine changed to Alanine
Institutional SourceAustralian Phenomics Network
Gene Model not available
AlphaFold P06332
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000024044)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells - decreased
immune system
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(24) : Targeted, knock-out(5) Targeted, other(8) Gene trapped(6) Spontaneous(2) Chemically induced(3

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 unclassified probably benign
thoth APN 6 124873140 splice site probably benign
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
Doubles UTSW 6 124872458 missense probably benign 0.01
fourless UTSW 6 124870244 critical splice donor site probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
R7038:Cd4 UTSW 6 124870254 missense probably damaging 0.98
R7083:Cd4 UTSW 6 124870572 missense probably benign 0.16
R7313:Cd4 UTSW 6 124867103 missense probably benign 0.15
R7394:Cd4 UTSW 6 124873041 missense probably benign 0.00
R7943:Cd4 UTSW 6 124870244 critical splice donor site probably null
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

Australian Phenome Bank: 4588  

Last Updated 2016-05-13 3:09 PM by Peter Jurek
Record Created 2010-10-14 9:47 AM by Nora G. Smart
Record Posted 2010-10-14
Phenotypic Description
Figure 1. Seshat homozygous animals display a reduced % of peripheral T cells (left) along with reduced CD4+ T cell numbers (right). Data is from APN.

The seshat phenotype was identified in a flow cytometry screen of blood from N-ethyl-N-nitrosourea (ENU)-mutagenized mice.  Homozygous seshat mice display reduced numbers of peripheral T cells and reduced CD4+ (cluster of differentiation 4) expression (Figure 1).      

Nature of Mutation

The Cd4 gene was directly sequenced as a candidate gene due to the reduced expression of CD4 in seshat mice, and corresponds to a T to C transition at position 543 of the Cd4 transcript, in exon 9 of 13 total exons using Genbank record NM_013488.

 

527 GAGGTGGAGTTGTGGGTGTTCAAAGTGACCTTC
120 -E--V--E--L--W--V--F--K--V--T--F-

 

The mutated nucleotide is indicated in red lettering and causes a valine to alanine change at amino acid 125 of the encoded protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 2. Domain structure of CD4. The Cd4 gene encodes a 457 amino acid single-pass type I transmembrane protein that belongs to the immunoglobulin superfamily of molecules. The protein contains a large extracellular region consisting of four immunoglobulin (Ig)-like domains (D1-D4). The most N-terminal of these domains (yellow) shares considerable homology with immunoglobulin κ light-chain variable regions, while the other three domains more closely resemble the constant domains of immunoglobulin molecules. The seshat mutation causes a valine to alanine change at amino acid 125 of the encoded protein. Click on the image to view other mutations found in CD4. Click on each mututation for more specific information.

The seshat mutation alters an amino acid located near the C-terminal end of the first immunoglobulin-like domain (D1) (Figure 2).

Please see the record for thoth for more information on Cd4.

Putative Mechanism

The reduced numbers, but not absence, of CD4+ T cells suggests that the seshat mutation is hypomorphic.  This is compatible with the missense nature of the mutation.  The seshat mutation is located in the D1 domain of CD4, which is known to bind to major histocompatibility complex (MHC) class II molecules.  The mutation may affect the binding of the D1 domain to MHC class II although Val 125 is not a key binding residue.  The reduced expression of CD4 in seshat animals may be due to instability of the missense protein or to reduced CD4 function that may cause increased numbers of non-MHC binding CD4+ T cells and subsequent elimination during the positive/negative stage of T cell development.

Primers Primers cannot be located by automatic search.
Genotyping

Genotyping protocols are from the Australian PhenomeBank. 

11B6 169b

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsChristopher C. Goodnow
Edit History
2011-01-04 2:55 PM (current)
2010-11-15 1:09 PM
2010-10-27 4:00 PM
2010-10-14 12:29 PM
2010-10-14 11:23 AM
2010-10-14 11:22 AM
2010-10-14 11:20 AM
2010-10-14 11:19 AM
2010-10-14 10:39 AM
2010-10-14 10:35 AM
2010-10-14 10:28 AM
2010-10-14 10:26 AM
2010-10-14 10:26 AM
2010-10-14 10:26 AM
2010-10-14 9:47 AM