Phenotypic Mutation 'kenny' (pdf version)
List |< first << previous [record 72 of 132] next >> last >|
Allelekenny
Mutation Type nonsense
Chromosome7
Coordinate
Base Change
Gene Muc2
Gene Name mucin 2
Synonym(s) 2010015E03Rik
Chromosomal Location 141,690,340-141,754,693 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Accession Number

Ensembl: ENSMUST00000026590; MGI: 1339364 

Mapped Yes 
Amino Acid Change Serine changed to Stop codon
Institutional SourceAustralian Phenomics Network
Ref Sequences
S1281* in Ensembl: ENSMUSP00000026590 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.2e-40 SMART
C8 218 292 3.1e-15 SMART
Pfam:TIL 295 351 1.6e-9 PFAM
VWC 353 413 5.6e-4 SMART
VWD 380 544 7e-44 SMART
C8 581 655 9.7e-37 SMART
SCOP:d1coua_ 656 730 1e-5 SMART
VWC_def 822 867 1e-2 SMART
VWD 850 1007 5.7e-31 SMART
C8 1043 1117 7.8e-35 SMART
low complexity region 1276 1367 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1435 1485 N/A INTRINSIC
VWD 1546 1714 2e-50 SMART
C8 1758 1831 7.2e-19 SMART
VWC 1888 1956 2.2e-4 SMART
VWC 1997 2061 9.2e-14 SMART
CT 2148 2231 1.4e-37 SMART
Phenotypic Category
Phenotypequestion? Literature verified References
inflammatory bowel disease phenotype
Penetrance 100% 
Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(2) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense unknown
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense probably benign
IGL01482:Muc2 APN 7 141754060 missense probably damaging 0.96
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense probably damaging 1.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense probably damaging 1.00
IGL02836:Muc2 APN 7 141746713
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2149:Muc2 UTSW 7 141699185 frame shift probably null
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 unclassified probably benign
R3112:Muc2 UTSW 7 141745488 unclassified probably benign
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 unclassified probably benign
R3974:Muc2 UTSW 7 141746804 unclassified probably benign
R3976:Muc2 UTSW 7 141746804 unclassified probably benign
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.32
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 unclassified probably benign
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 unclassified probably null
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6321:Muc2 UTSW 7 141700828 missense probably benign 0.28
R6390:Muc2 UTSW 7 141752146 missense probably damaging 0.97
R6485:Muc2 UTSW 7 141746736 unclassified probably benign
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
R6683:Muc2 UTSW 7 141751477 missense probably benign 0.38
R6896:Muc2 UTSW 7 141752695 missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141698733 missense probably damaging 1.00
R6924:Muc2 UTSW 7 141697834 missense possibly damaging 0.87
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

Australian Phenome Bank: 2441

Last Updated 2018-04-25 11:21 AM by Anne Murray
Record Created 2010-10-14 12:39 PM by Nora G. Smart
Record Posted 2010-10-14
Phenotypic Description

The kenny phenotype was identified amongst the G3 progeny of an ENU-treated C57BL/6 founder by their visible phenotype of spontaneous watery diarrhoea and high incidence of rectal bleeding and prolapse, suggestive of ulcerative colitis. 

Nature of Mutation

The kenny mutation corresponds to a C to A transversion at position 3842 of the Muc2 transcript ENSMUST00000026590 in exon 31 of 48 total exons.

 

3826 ACTCCTTCAACTATCTCACCTACAACTTCAACA
1276 -T--P--S--T--I--S--P--T--T--S--T-

 

The mutated nucleotide is indicated in red lettering, and causes a premature stop codon at serine 1281 of the MUC2 protein (amino acid 1394 according to Uniprot Q80Z19).

Protein Prediction
Figure 1.  Domain structure of Mucin2. The kenny mutation causes a serine to premature stop in the TR2 domain of the MUC2 protein. S=Signal sequence; D=D domains (homology to VWF mediates trimerization); CR=Cystein-rich domain; TR= Tandem repeat domain (heavily O glycosylated); GDPH=GDPH autocatalytic proteolytic site; B=B domain (homology to VWF); C= C domain (homology to VWF); CK= Cysteine-knot domain (homology to VWF mediates dimerization). This image is interactive. Click on the image to view other mutations found in Mucin2 (red). Click on the mutations for more specific information.

The kenny mutation prematurely truncates the MUC2 protein following the third VWF-like domain and first cysteine-rich (CR) domain (Figure 1).  This would truncate most of the protein and likely leads to nonsense-mediated protein decay. The effects of the mutation on protein expression are unknown.

For more information about Muc2, please see the record for Schlendrian.
Putative Mechanism

Due to the premature truncation of the MUC2 protein, the kenny mutation is likely to represent a null allele. However, the possibility remains that truncated MUC2 is expressed, in which case it will undergo aberrant oligomerization due to the lack of critical domains important for this function.  Aberrantly oligomerized MUC2 has been shown to accumulate in the endoplasmic reticulum (ER), which leads to ER stress, triggering of the unfolded protein response (UPR), subsequent inflammation and goblet cell apoptosis (1).  

Primers Primers cannot be located by automatic search.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsChristopher C. Goodnow
List |< first << previous [record 72 of 132] next >> last >|
Edit History
2011-06-10 4:34 PM (current)
2011-04-24 11:39 AM
2011-01-04 2:52 PM
2010-12-16 11:01 AM
2010-12-16 10:59 AM
2010-12-16 10:59 AM
2010-10-14 2:20 PM
2010-10-14 2:19 PM
2010-10-14 2:19 PM
2010-10-14 2:18 PM