Phenotypic Mutation 'lasvegas'

• Allele: lasvegas
• Mutation Type: unclassified
• Chromosome: 10
• Coordinate: 19,010,758 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Tnfaip3
• Gene Name: tumor necrosis factor, alpha-induced protein 3
• Synonym(s): A20, Tnfip3, zinc finger protein A20
• Chromosomal Location: 18,876,658-18,891,158 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012] ; PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Australian Phenomics Network
• Gene Model: not available
• AlphaFold: Q60769
• SMART Domains: Protein: ENSMUSP00000019997; Gene: ENSMUSG00000019850

Domain	Start	End	E-Value	Type
Pfam:OTU	98	257	1.2e-30	PFAM
ZnF_A20	384	409	8.06e-9	SMART
low complexity region	425	436	N/A	INTRINSIC
ZnF_A20	467	492	3.76e-9	SMART
ZnF_A20	503	526	4.74e-6	SMART
low complexity region	528	543	N/A	INTRINSIC
ZnF_A20	589	614	6.01e-8	SMART
ZnF_A20	639	664	1.56e-6	SMART
ZnF_A20	698	723	1.68e-6	SMART
ZnF_A20	744	769	2.81e-8	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000101167; Gene: ENSMUSG00000019850

Domain	Start	End	E-Value	Type
Pfam:OTU	98	257	7.8e-34	PFAM
ZnF_A20	384	409	8.06e-9	SMART
low complexity region	425	436	N/A	INTRINSIC
ZnF_A20	467	492	3.76e-9	SMART
ZnF_A20	503	526	4.74e-6	SMART
low complexity region	528	543	N/A	INTRINSIC
ZnF_A20	589	614	6.01e-8	SMART
ZnF_A20	639	664	1.56e-6	SMART
ZnF_A20	698	723	1.68e-6	SMART
ZnF_A20	744	769	2.81e-8	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000116318; Gene: ENSMUSG00000019850

Domain	Start	End	E-Value	Type
PDB:2VFJ|D	1	122	2e-83	PDB
SCOP:d1e3ha3	18	109	2e-3	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000120627; Gene: ENSMUSG00000019850

Domain	Start	End	E-Value	Type
PDB:3ZJG|B	1	87	1e-56	PDB

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm
• Last Updated: 2017-04-06 9:17 AM by Katherine Timer
• Record Created: 2010-12-28 2:01 PM by Eva Marie Y. Moresco
• Record Posted: 2014-07-11
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Hua Huang, Christopher Goodnow, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001166402, NM_009397; Ensembl: ENSMUST00000019997; MGI: 1196377

Alleles Listed at MGI

All alleles(9) : Targeted(9)

Repository

Australian Phenome Bank

Phenotypic Description

The lasvegas mutation was identified while analyzing blood from N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice using flow cytometry.  Homozygous lasvegas animals displayed increased myeloid cells, a lower percentage of lymphocytes, and an increased percentage of activated/memory T cells expressing high levels of the activation marker cluster of differentiation 44 (CD44).

Figure 1. Tnfaip3 curtails the effects of MYD88 L265P on B cells. (A) EGFP + B cells expressing the indicated vectors were sorted from three independent cultures on day 1, and mRNA from each cell was converted to cDNA and analyzed on microarrays. Shown are the mean and SD arbitrary units of Tnfaip3 mRNA and a constitutively expressed B cell transcript, Cd79a , from each sample. *, P < 0.05. (B) WT or Tnfaip3 lsv ( las vegas ) homozygous mutant polyclonal B cells were transduced with the indicated vectors and cultured in triplicates in the absence of mitogenic stimuli for 5 d. The number of EGFP + transduced B cells and EGFP − nontransduced control B cells in each culture was compared with the starting number on day 0 (mean and SD). Data are representative of three independent experiments. (C) Western blot analysis of EGFP + WT or Tnfaip3 lsv polyclonal B cells expressing the indicated vectors, sorted on day 1 of culture without mitogenic stimuli, measuring phosphorylated p65 NF-κB. Tubulin was used as a loading control. (D) Relative expression of CD23, CD25, CD95, and CD86 on EGFP + WT or Tnfaip3 lsv polyclonal B cells expressing MYD88 L265P or empty vector compared with nontransduced EGFP − B cells in the same culture. Mean and SD for triplicate cultures per group. Statistical analysis by Student’s t test: *, P < 0.05; **, P < 0.01; ***, P < 0.001. Data are representative of two independent experiments. (E) WT or Tnfaip3 lsv homozygous HEL-specific B cells were activated by HEL in vivo and anti-CD40 in vitro, transduced with indicated vectors, and cultured in triplicates in the absence of mitogenic stimuli for 7 d, and the number of EGFP + transduced B cells and EGFP − nontransduced B cells in each culture compared with starting number on day 0 (mean and SD). Data are representative of two independent experiments. (F) Division of HEL-specific B cells measured by CTV dilution on days 1, 3, and 5 of triplicate cultures in the absence of antigen or anti-CD40 stimuli. Cells were gated on WT or Tnfaip3 lsv transduced with MYD88 L265P or nondividing B cells transduced with empty:EGFP vector (gray histogram) showing the median and SD CTV intensity. Data are representative of two independent experiments. Figure obtained from ( 1 ).

A mutant Myd88 (Myd88^L265P) induced rapid B cell division in the absence of exogenous Toll-like receptor (TLR) ligands (1). The mRNA levels of Tnfaip3 in B cells transduced with Myd88^L265P were increased 3-fold compared to cells transduced with empty:EGFP vector (Figure 1A). B cells from homozygous lasvegas mice, which bear a hypomorphic mutation in Tnfaip3, exhibited continued increases in number between days 3 and 5 after transduction with Myd88^L265P compared to wild-type B cells expressing Myd88^L265P  that exhibited a rapid drop in number (Figure 1B & 1E; (1)]. At day 3 after transduction of Myd88^L265P, wild-type and lasvegas B cells cultured with the cell division tracking dye CTV displayed similar levels of CTV dilution; by day 5 the lasvegas cells exhibited greater CTV dilution than wild type cells [Figure 1F; (1)].  Wild-type B cells expressing Myd88^L265P exhibited decreased p65 NF-κB phosphorylation (Figure 1C) as well as decreased expression of CD23, CD25, CD95, and CD86 compared to wild-type B cells expressing wild-type Myd88 (Figure 1D). In contrast lasvegas B cells did not exhibit a decrease in p65 phosphorylation (Figure 1C) or changes in expression of CD23, CD25, CD95, and CD86 upon Myd88^L265P expression (Figure 1D).  These findings suggest that NF-κB activation and B cell proliferation induced by Myd88^L265P are counteracted by A20.

Nature of Mutation

The lasvegas mutation was mapped to Chromosome 10, and corresponds to a T to A transversion at position 1247 of the Tnfaip3 transcript using Ensembl record ENSMUST00000019997, in exon 6 of 9 total exons.

1231 GGCACGACTCACCTGATCAACGCTGCAAAATTG

320  -G--T--T--H--L--I--N--A--A--K--L-

The mutated nucleotide is indicated in red lettering and causes an isoleucine to asparagine change at amino acid 325 of the encoded protein.

Protein Prediction

Figure 2. Domain structure of A20. The lasvegas mutation causes an isoleucine to asparagine change at amino acid 325 of the coded protein. OTU, ovarian tumor domain; ZF, zinc finger.

The Tnfaip3 or A20 gene encodes a 775 amino acid zinc finger protein known as A20 or TNF-α induced protein 3 (TFNAIP3) (Figure 2).  A20 plays a key role in the negative regulation of inflammation and immunity by regulating the nuclear factor (NF)-κB pathway as well as programmed cell death [reviewed in (2-4)].  The protein is composed of an N-terminal ovarian tumor (OTU) domain (5) at amino acids 1-366, and a C-terminal domain (amino acids 373-775) that contains seven zinc fingers (ZnFs), of which 6 have the sequence CX₄CX₁₁CX₂C and one is similar to the sequence CX₂CX₁₁CX₂C (6).  A20 sequences, particularly in the zinc fingers and the OTU domain, are highly conserved in mammalian species with mouse A20 displaying 90% identity to the human protein and 96% similarity.  The zinc fingers domains of mouse and human A20 have complete identity at all positions except for a single substitution of methionine for valine in the fourth finger (7).  A20 proteins are also found in Danio rerio and Xenopus laevis, but not in Drosophila melanogaster and Caenorhabditis elegans (3). 

Like other OTU domains, the OTU domain of A20 has been demonstrated to have deubiquitinase (DUB) activity (8;9).  Ubiquitin is a 76 amino acid protein that is covalently attached to other proteins in a highly regulated process involving the stepwise activity of an E1 ubiquitin activating enzyme, E2 conjugating enzymes and E3 ubiquitin ligases.  E3 ubiquitin ligases recruit specific protein substrates and enable the attachment of ubiquitin to a specific lysine or free amino terminus of the target substrate.  Each of the seven lysines in ubiquitin can be coupled to another ubiquitin resulting in polyubiquitin chains.  The type of polyubiquitin chain thus formed determines the fate of the target protein.  Polyubiquitin linked through Lys48 (K48) or K11 of ubiquitin results in proteasomal degradation, while K63-linked or linear polyubiquitination can mediate binding of other proteins containing specific ubiquitin-binding domains and are associated with substrate activation or relocalization (4).  The A20 OTU domain can depolymerize several types of ubiquitin chains in vitro (8-11), and has been shown to remove K63-linked ubiquitin chains from a number of proteins involved in NF-κB regulation and programmed cell death including receptor interacting protein kinase 1 (RIPK1 or RIP1) (8;12), RIP2 (13), the E3 ubiquitin ligase TNF receptor-associated factor 6 (TRAF6) (14;15), the protease mucosa-associated lymphoid tissue translocation gene 1 (MALT1) (16), the scaffolding protein NF-κB essential modulator (NEMO or inhibitor of kappa-B kinase-γ/IKK-γ; see the record for panr2) (17), and the caspase-8 protease (18).  Despite this activity, the A20 OTU domain has been shown to lack intrinsic K63 specificity suggesting that it may need additional factors in order to deubiquitinate its substrates (10;11).  A20 is known to interact with various ubiquitin-binding proteins including NEMO (19;20), the A20 binding inhibitor of NF-κB (ABIN) family of proteins (21-24), Tax binding protein 1 (TAX1BP1) (19;25), and the novel protein Ymer (26); these proteins may co-localize A20 with K63-ubiquitinated substrates.  Both NEMO and TAX1BP1 interact with TRAF6 and RIP1 (20;27-29).  Ymer binds to RIP1 (26), while the ABIN proteins interact with NEMO (17;30). 

Figure 3. Structure of the OTU domain of human A20. The location of the las vegas mutation is noted. UCSF Chimera model based on PDB:2VFJ and (11). This image is interactive. Click on the 3D structure to view it rotate.

The A20 N-terminal region containing the OTU domain is known to interact with a number of proteins including TRAF1 and TRAF2 (31), Ymer (26), TRAF family member-associated NF-kappa-B activator (TANK)-binding kinase 1(TBK1), and inhibitor of kappa-B kinase ε (IKK-ε) (32).  The crystal structure of the A20 OTU domain (Figure 3; PDB ID 2VFJ, 3DKB) shows ten β-strands and ten α-helices arranged into an anterior α-helical domain, a central β-sandwich domain and a posterior α-helical domain.  The helices are mostly from the N-terminal half of the OTU domain whereas the β strands are mostly from the C-terminal half.   The central β-sandwich domain has a five-stranded β-sheet (β1–β5) opposed by a three-stranded β-sheet (β6, β9, and β10).  β9 and β10 also extend to form a β-hairpin that packs against the β-hairpin formed by strands β7 and β8.  These β-hairpins are unique to the A20 OTU domain.  The posterior domain is formed by helices α4–α9 while the anterior domain is formed by helices α1–α3 and α10 (10;11).  OTU domains share a cysteine protease catalytic triad common to other deubiquitinase families consisting of a catalytic cysteine residue (Cys103 in A20), a histidine residue to abstract the cysteine proton and stabilize the nucleophile (His256 in A20), and an often negatively charged residue to stabilize the histidine.  The deprotonated Cys residue then attacks the scissile isopeptide bond at the ubiquitin C-terminus.  An oxyanion hole close to the catalytic cysteine residue stabilizes the reaction intermediate.  Mutation of Cys103 and His256 abolishes deubiquitinase activity and confirms these as catalytic residues (8;9).  However, the identity of the third catalytic residue of A20 is not clear, and the architecture of the oxyanion hole differs from the majority of OTU domains found in other proteins.  The oxyanion hole is formed by the backbone amide atoms of Asp100, Gly101 and Cys103 (10;11).  Two disordered loops between α6 and α7 (residues 152-160) and β2 and β3 (residues 212-228) may bind a distal ubiquitin, while the invariant residues Leu10, Asn98, Asp100, Thr118 and Gln187 may bind a proximal ubiquitin (11).  Instead of interacting with ubiquitin, these latter residues have also been suggested as a substrate binding site.  However mutagenesis of these residues do not affect the ability of A20 to deubiquitinate either polyubiquitinated TRAF6 or Lys48-linked polyubiquitin chains (10).  Other modeling studies suggest that ubiquitin binding of A20 may require the surface formed by α4, α7, α8, β2, β3, β4, β5, and the loops between them.  The majority of this surface is negatively charged, complementing the positively charged surface of ubiquitin.  Mutation of residues in this interface (Leu157, Tyr159, Ser190, Glu192, Phe224 and Leu227) disrupt the DUB activity of A20 (10).  The surface opposite the active site is also highly conserved and may interact with A20 substrates.  This surface is mainly formed by the linker region between β8 and α11 (residues 330–340) and loop 263–271, which contribute the invariant residues Glu332, Asn334, Arg271, Lys264 and Ser266 (11).

Figure 4. Crystal structure of the A20 ZnF4, uniquitin, and UbcH5A complex. The zinc molecule is shown in gray. No direct contact between the structures is observed. UCSF Chimera model based on PDB:3OJ4 and (34). This image is interactive. Click on the 3D structure to view it rotate.

The C-terminal zinc finger domain of A20 interacts with NEMO, TAX1BP1, the ABIN proteins, IKK-1 (or IKK-α) and itself [reviewed in (3;4)].  In conjunction with the OTU domain, it also binds TBK1 and IKK-ε (32) and the E2 ubiquitin conjugating enzymes UBCH13 and UBCH5C (33).  ZnF4, in particular, is associated with TAX1BP1, UBCH13 and UBCH5C (33), while ZnF1 provides substrate recognition of RIP1 (34).  A conserved sequence between ZnF3 and ZnF4, RSKSDP, binds the chaperone and adaptor molecule 14-3-3.  This motif is not required for NF-κB inhibition (35;36), although some data suggests that interaction with 14-3-3 protects A20 from degradation (37).  ZnF4 has been proposed to be an E3 ubiquitin ligase domain, and can polymerize K48 but not K63-linked polyubiquitin chains (8).  A20 has been shown to ubiquitinate RIP1 (8), and is important for K48-linked ubiquitination of UBCH13 and UBCH5C although whether it can directly ubiquitinate these proteins remains unclear (33).  Structural studies of the A20 ZnF3-4 region in conjunction with ubiquitin and the E2 ubiquitin ligase UBCH5A (Figure 4; PDB ID 3OJ3; 3OJ4) suggest that ZnF4 does not directly bind to E2 ubiquitin conjugating enzymes and that ZnF5-7 instead provides specificity for UBCH5A interaction.  Interaction with other E2 enzymes like UBCH13, UBCH5C, UBCH3 and UBCH7 may also occur directly through this site (8;33), while ZnF4 associates indirectly with them through ubiquitin binding.  ZnF4 selectively recognizes K63-linked polyubiquitin chains and interacts with three separate ubiquitin molecules. The first ubiquitin binding site involves a variation of an inverted ubiquitin-interacting motif (IUIM) and is formed by the C-terminal α-helix of ZnF4.  The second ubiquitin contact site occurs just N-terminal to the α-helix, while the third site is located at the very N-terminus of ZnF4 and involves 12 residues.  Mutations in these regions decrease A20-mediated ubiquitination (34).  Mutations targeting the zinc-coordinating cysteines (Cys592, Cys597, Cys609 and Cys612) also reduce A20 activity (8;34).

A20 has been shown to interact with various other proteins although the interacting domains have not been defined.  These include the E3 ubiquitin ligases ITCH (38) and RNF11 (39), latent membrane protein 1 (LMP1) (40), and the TLR adaptor molecule TRIF [Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-β] also known as TICAM-1 (TIR domain-containing adaptor molecule-1; see the record for Lps2) (41).  TAX1BP1 is thought to recruit ITCH and RNF11 to A20 to form a ubiquitin-editing protein complex (38;39) suggesting that ITCH and RNF11 may actually be responsible for A20-mediated ubiquitination of target proteins rather than the A20 ZnF4 domain.

Human A20 is phosphorylated at Ser381 by IKK-2 or IKK-β in response to TNF or lipopolysaccharide (LPS) stimulation, an event that increases its inhibitory activity towards NF-κB (42).  Human A20 is cleaved after Arg439 between ZnF1 and ZnF2 by MALT1 in response to T cell receptor (TCR) and B cell receptor (BCR) stimulation (43) and is subject to proteasomal degradation (16;43).  The human A20 cleavage site for MALT1 is not conserved in mouse A20, but mouse A20 is also cleaved by MALT1 likely between ZnF3 and ZnF4 as suggested by the size of the resulting protein fragments (43). 

The amino acid altered by the lasvegas mutation occurs in β10 of the OTU domain.

Expression/Localization

In mice, constitutive A20 mRNA expression is detected in epithelial cells involved in early hair follicle development, but the highest levels of A20 mRNA are seen in lymphoid tissues such as thymus, gut-associated lymphoid aggregates containing B and T cells, and spleen.  In the embryo, low levels of A20 mRNA are detectable in most tissues (7).  A20 is expressed in mouse enterocytes as soon as the gut becomes colonized by bacteria, a process that is initiated right after birth (44). 

In both humans and mice, TNF and other pro-inflammatory cytokines dramatically increase A20 mRNA expression in most tissues (12;45).  The TNFAIP3 promoter contains two κB elements and is responsive to NF-κB activation (46).  Most stimuli that are able to activate the NF-κB pathway induce A20 expression depending on the cell type [Table 1; see (3) and references therein].  In contrast, human immature thymocytes and resting peripheral T cells that constitutively express A20 mRNA display decreased expression when activated (7;16).  The 3’-untranslated region (UTR) of the A20 mRNA contains an mRNA destabilizing motif frequently found in the 3’-UTRs of early response inflammatory mediators (45).  A20 negatively regulates its own expression by inhibiting NF-κB activation (46).

A20 expression levels are dysregulated in certain cancers.  A20 mRNA is upregulated in undifferentiated nasopharyngeal carcinoma and poorly differentiated head and neck squamous cell carcinomas of the skin, and is associated with poor prognosis in some breast cancers (47;48).  However, a large number of B cell lymphomas contain mutations in A20 resulting in a loss of A20 protein expression [reviewed in (4)], and patients with Crohn’s disease (CD) display decreased mucosal expression of A20 mRNA (49). 

A20 is primarily cytoplasmic, but a fraction of endogenous and ectopically expressed A20 is localized to a perinuclear membrane compartment that interacts dynamically with lysosomes.  This localization requires the C-terminal zinc fingers of A20 (50).  The interaction of A20 with 14-3-3 alters the localization of A20 from a punctate cytoplasmic staining to a more diffuse cytoplasmic pattern (35).

Background

Figure 5. Inhibition of NF-κB signaling by A20 ubiquitination. CD40 receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination (lavender) and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination (light blue), and enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKa which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the proteasomal degradation of p100  (small green circles) and the processing of p52. RelB and p52 are released for translocation into the nucleus. Stimulation of the B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. TNFR, TLR4, and IL-1R signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKa and IKKb). Activated NOD2 recruits RIP which also activates the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IkB and p105 ubiquitination and degradation (small pink circles). Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A20 is a deubiquitinating enzyme that inhibits NF-κB signaling by disassembling K63-linked ubiquitin chains from RIP, TRAF6, and NEMO. The K63 chains are replaced with K48-linked ubiquitin chains, targeting them for degradation. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

A20 was first identified as a primary response gene of the pro-inflammatory cytokines TNF-α, IL-1β and the TLR4 ligand LPS in human cells (45).  As described above, A20 transcription is rapidly induced following NF-κB activation and then functions as a negative feedback regulator of the NF-κB pathway, which regulates the expression of various cytokines and other modulators of the inflammatory process and enhances the survival of cells through the regulation of antiapoptotic genes (Figure 5).  The NF-κB family of transcription factors consists of the evolutionarily conserved proteins p65/RelA, c-Rel, RelB, p50 (derived from the p105 precursor) and p52 (derived from the p100 precursor; see the record for xander).  Typically, the rapid and transient activation of NF-κB complexes in response to a wide range of stimuli such as proinflammatory cytokines, DNA damaging agents, TLR agonists, and viruses is regulated by the canonical NF-κB pathway.  These signals are mediated by various cell surface or intracellular receptors including the TNF receptor (TNFR) superfamily, the TIR domain family, BCR, TCR, nucleotide binding oligomerization domain (NOD)-like receptors and retinoic acid-inducible gene 1 (RIG-1) like helicases (RLHs).  Receptor activation promotes the recruitment of adaptor proteins resulting in specific signaling complexes that converge on and activate the IKK complex composed of IKK-1, IKK-2 and NEMO [for review see (51;52)].  In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with the IκB inhibitory molecules IκBα, IκBβ, and IκBε (53).  In response to stimulation, the IκB proteins are phosphorylated by the IKK complex at conserved serine residues resulting in K48-linked polyubiquitination of IκB molecules and subsequent proteolysis.  Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes (51;52).  Genetic studies have demonstrated that the IKK-2 and NEMO subunits of the IKK complex are required for canonical NF-κB activation (54), while IKK-1 and the NF-κB inducing kinase (NIK; see the record for lucky) are required for the non-canonical or alternative NF-κB pathway (55).  The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52, and results in the activation of p52/RelB heterodimers (51;56-58).

As described above, A20 interacts with several proteins known to participate in NF-κB signaling pathways.  These include RIP1 and TRAF2 downstream of TNFR1; TRAF6 downstream of the TLRs and IL-1R; RIP2 downstream of NOD2; and NEMO (2-4).  In response to receptor stimulation, K63-linked polyubiquitin chains are added to these molecules.  These chains are thought to act as scaffolds allowing the recruitment of important signaling molecules including the IKK complex or TAK1 [TGFβ (transforming growth factor β)-activated kinase-1] complex, which is important in TNFR, IL-1R, and TLR signaling.  Subsequently, TAK1 activates IKK-2 [reviewed in (59)].  A20 is thought to inhibit NF-κB activity through both its deubiquitinating and ubiquitinating activities (8).  In the case of RIP1, A20 first removes the activating K63-linked polyubiquitin chain, and then adds K48-polyubiquitin chains to target RIP1 for proteasomal degradation (8).  A20 is also known to deubiquitinate TRAF6 (14), RIP2 (13) and NEMO, although the role of NEMO ubiquitination in NF-κB activation remains unclear (17;60).  However, none of these proteins are targets of A20 K48-linked ubiquitination (3;4).  A20 also inhibits NF-κB activation by targeting the RIP1 associated molecule TRAF2 to the lysosomes for degradation, an activity that does not require its ubiquitin modifying property (61).  Other mechanisms A20 employs to interfere with the NF-κB pathway include TRAF6 binding, which prevents TRAF6 from interacting with the E2 conjugating enzymes UBCH13 and UBCH5 and inhibits its E3 ligase function.  A20 also disrupts the interaction between UBCH13 and the E3 ubiquitin ligases cIAP1 (cellular inhibitor of apoptosis protein 1) and TRAF2 upon TNF stimulation.  As described above (Protein Prediction), A20 is also required for K48-linked ubiquitination and subsequent degradation of UBCH13 and UBCH5 (33).  In B and T cells that express A20 constitutively, activation of the NF-κB pathway in response to BCR and TCR stimulation requires A20 inactivation.  This occurs via proteolytic processing by MALT1, as well as proteasomal degradation (16;43).

In addition to inhibiting NF-κB activity, A20 further affects inflammation by inhibiting interferon (IFN) regulator factor 3 (IRF3) activation downstream of RIG-I and TLR3, which normally results in the production of IFN-β (41;62).  A20 appears to affect IRF3 activation at the level of TBK1 and IKK-ε, which are required for IRF3 activation (41).  A20 also may negatively regulate mitogen activated protein kinase (MAPK) signaling downstream of TNF, IL-1, and LPS stimulation (12;63;64), although this activity appears to be cell specific.  Finally, A20 is also important in apopotosis and cell survival by protecting certain cell types from TNF-induced apoptosis (12;65), Fas-induced apoptosis (66) and p53-induced apoptosis following viral infection (67).  In addition, A20 downregulation may be important in activation-induced cell death (AICD) in T cells (68).  The ubiquitin-editing activity of A20 is likely important in its anti-apoptotic role as A20 can deubiquitinate K63-linked caspase-8, which is a common component of both TNF- and Fas-induced apoptosis.  Caspase-8 ubiquitination is required for caspase-8 aggregation, leading to its full activation and processing (18).  A20 can also inhibit necrosis.  In some cell types, A20 overexpression has been reported to be pro-apoptotic.  These paradoxical effects may be due to a balance that exists between the direct anti-apoptotic effect of A20 and an indirect pro-apoptotic effect caused by its NF-κB inhibitory function (3).  A summary of A20 biological activities are listed in Table 1.

Table 1. Biological activities of A20*, **

Function	Stimulus	Cell Types	Evidence	Mechanisms
Anti-apoptotic	TNF	Thymocytes, endothelial cells, β-cells, Jurkat, rat hippocampal neurons, fibroblasts, osteoblasts, hepatocytes, glioma stem cells, various cell lines	knockout; overexpression; RNAi	Prevents RIP1 and TRADD recruitment to TNFR1; inhibits p53; inhibits Bax expression
	Fas	Endothelial cells	overexpression	Caspase 8 deubiquitination
	TRAIL	Lung carcinoma	overexpression
	Natural killer cells	Endothelial cells	overexpression
	Serum deprivation	B cells	overexpression
	Serum from burn patients	Human umbilical vein endothelial cells (HUVEC)	overexpression
	LPS	Human microvascular endothelial cells (HMEC-1)	overexpression
	CD40	Human coronary artery endothelial cells (HCAEC)	overexpression
	AICD	T cell hybridomas	overexpression
	etopside	Lymphoblastoid cells	RNAi
	H202	Lymphoblastoid cells	RNAi
Anti-necrosis	TNF	L929	overexpression	Inhibition of phospholipases; production of reactive oxygen species
	Complement	Enodthelial cells	overexpression
	Hypoxia-reoxygenation	Mouse hepatocytes	overexpression	Increase in PPARα expression
	H202	Mouse hepatocytes	overexpression
Pro-apoptotic	Fas and cytokine	Vascular smooth muscle cells (VSMC)	overexpression	NF-κB inhibition
NF-κB inhibition	TNF	Bovine aortic endothelial cells (BAEC), various cell lines	knockout; overexpression; RNAi	Ubiquitin editing and degradation of RIP1; deubiquitination of NEMO; inhibition of TRAF/cIAP1 E3 ligase activity by antagonizing the interaction with E2 enzymes; induction of proteasomal degradation of E2 enzymes; degradation of TRAF2 via lysosomes;
	IL-1	Human airway epithelial cells, macrophages, various cell lines	knockout; overexpression	Deubiquitination of TRAF6
	LPS	BAEC, macrophages, various cell lines	knockout; overexpression	Inhibition of TRAF6 E3 ligase activity by antagonizing the interaction with E2 enzymes; induction of proteasomal degradation of E2 enzymes
	H202	HeLa, endothelial cells	overexpression; RNAi
	TPA	BAEC, HEK293T	overexpression
	anti-CD3	Jurkat	RNAi	MALT1 deubiquitination
	API-MALT1	HEK293T	overexpression
	RIG-1	HEK293	overexpression
	Helicobater pylori	Human gastric cancer cells	overexpression
	Influenza virus	Human bronchial epithelial cells	overexpression
	Peptidoglycan	Human airway epithelial cells	overexpression
	Serum from burn patients	HUVEC	overexpression
	CD40	HEK293T	overexpression
	TNFRII	HEK293T	overexpression
	NOD1/NOD2	HEK293T	overexpression	RIP2 deubiquitination
	LMP1	Human keratinocytes, HEK293	overexpression
AP-1 inhibition	TNF	MCF7S1 (breast cancer cell line)	overexpression
	IL-1	MCF7S1	overexpression
	LMP1	HEK293	overexpression
	TLR4	HEK293	overexpression
IRF3 inhibition	RIG-1	HEK293	overexpression
	TRIF	HEK293	overexpression	Reduction of TRIF expression
	Sendai virus	HEK293	overexpression; RNAi
	Poly (I:C)	various cell lines	overexpression; RNAi
	Newcastle disease virus	HEK293/TLR3	overexpression; RNAi
	IKK-ε/TBK1; VSV	HEK293	overexpression	Inhibition of IKK-ε/TBK1 ubiquitination by disrupting TRAF3 interaction
Skin differentiation			knockout mice	Impaired NF-κB activation; interaction with IKK-1
Cell cycle arrest		VSMC		Inhibition of PI3K/PKB/GSK3β signaling; upregulation of p53, p21waf1 and p27kip
Mitogenic in the liver			adenoviral gene delivery in mice
Neovascularisation		HUVEC	RNAi

*Abbreviations: AP-1, activator protein 1; GSK3β, glycogen synthase kinase 3 beta; MEF, mouse embryonic fibroblasts; ; PI3K, phosphoinositide 3 kinase; PKB, protein kinase BPKB; PPAR, peroxisome proliferator-activated receptor; TPA, tissue plasminogen activator; TRADD, tumor necrosis factor receptor type 1-associated DEATH domain protein; TRAIL, TNF-related apoptosis-inducing ligand; VSV, vesicular stomatitis virus

** from reference (3)

The roles of A20 in NF-κB inhibition and apoptosis were confirmed in vivo by the generation of A20 ^-/- knockout mice.  These animals display partial postnatal lethality, runting, and severe inflammation in the liver, kidneys, joints, intestines, and bone marrow, and were hypersensitive to LPS and TNF.  A20-deficient cells fail to terminate TNF-induced NF-κB activation and are more susceptible to TNF-mediated programmed cell death, although they remain capable of inhibiting IL-1β-induced NF-κB responses (12).  A20-deficient mice are also unable to terminate TLR- and NOD-induced NF-κB activation (13;14), and the multi-organ inflammation and premature death seen in these animals is caused by deregulated TLR signaling in myeloid cells in response to commensal intestinal flora (15).  A20 activity in intestinal epithelial cells (IECs) is also important as mice lacking A20 specifically in IECs are susceptible to experimentally-induced colitis due to the hypersensitivity of these cells to TNF-induced apoptosis, which compromises epithelial integrity and allows contact with and an immune response to commensal bacteria (69).  Similarly, mice lacking p65 in IECs are also sensitive to chemically-induced colitis (70), while mice lacking either NEMO or IKK-2 in their IECs develop severe chronic intestinal inflammation (71;72).  A20^-/-mice also show thickening of epidermal and dermal layers without apparent inflammation (12), a phenotype similar to one seen in IκBα ^-/- mice (73) and suggesting that A20 may affect skin differentiation via NF-κB regulation.  Loss of IKK-1 similarly affects skin differentiation (25;74), but independently of NF-κB.  As IKK-1 interacts with A20 (74), it is possible that A20 affects IKK-1 function during skin development.  Conditional knockout of A20 in B cells results in a number of phenotypes including hyperresponsiveness to multiple stimuli, increased NF-κB activation and cell survival, an increased number of immature B cells, and eventually autoimmunity (75;76).  The differentiation of marginal zone B (MZB) and B-1 cell subsets were also reported to be affected (76). 

In humans, loss of A20 activity is associated with various cancers and inflammatory diseases [reviewed in (2;4)].  Chronic inflammation can be oncogenic with persistent NF-κB activation playing a critical role in cancer development and progression.  NF-κB proteins induce the expression of TNF-α, IL-1, IL-6, and granulocyte macrophage colony stimulating factor (GMCSF), which upregulate cell cycle factors and promote self-sufficient cell growth.  In addition, NF-κB upregulates genes encoding proteins that enable the evasion of apoptosis, sustained angiogenesis, and tissue invasion and metastasis.  Thus, it is not surprising that A20 mutations followed by increased NF-κB activation result in many B cell lymphomas including marginal zone lymphoma (MZL), diffuse large B cell lymphoma (DLBCL), mantle cell lymphoma (MCL), MALT lymphoma, Hodgkin’s lymphoma, primary mediastinal B cell lymphoma (PBML), Burkitt’s lymphoma, and follicular lymphoma.  A20 also functions as a tumor suppressor in natural killer cell lymphoma and adult T cell leukemia/lymphoma (ATLL) [see (4) and the references therein].  MALT1, which cleaves and inactivates A20 downstream of TCR and BCR signaling, is constitutively active in MALT lymphomas (77).  Polymorphisms in or near the human A20 gene are associated with several autoimmune and inflammatory disorders including Crohn’s disease (CD), celiac disease, psoriasis, rhematoid arthritis (RA), type I diabetes, atherosclerosis, and systemic lupus erythematosus (SLE) [reviewed in (2)].  In many of these disorders including RA, TNF and other proinflammatory cytokines play central roles in the development of disease, and the absence of A20 inhibitory function on TNF-induced signals is likely to exacerbate symptoms (78;79).  One of the main mechanisms causing death of the pancreatic insulin-producing β-cells leading to type I diabetes is the release of inflammatory mediators by activated immune cells, a process involving NF-κB activation (80).  Thus, uncontrolled NF-κB activation due to reduced A20 expression may result in diabetes.  A20 has also been shown to inhibit apoptosis in β-cells (81).  In mouse models of psoriasis and atherosclerosis (which often occur together), the region ecompassing the mouse A20 gene contributes to disease susceptibility (82;83).  An A20 polymorphism in atherosclerosis-susceptible mice causes increased NF-κB activation (82).

Putative Mechanism

The lasvegas mutation alters a conserved amino acid in the OTU domain of the A20 protein.  Interestingly, the OTU domain is dispensable for the NF-κB or IRF3 inhibitory activity of overexpressed A20, as overexpression of the C-terminal domain or the OTU catalytic cysteine mutant can still potently inhibit TNF-, IL-1- and TLR-induced NF-κB and IRF3 activation (9;21;31;32;37).  However, reconstitution of A20^-/- mouse embryonic fibroblasts with the OTU catalytic cysteine mutant demonstrates that this domain is required for the inhibitory effects of A20 on TNF-induced NF-κB activity (8).  It is likely that the lasvegas mutation disrupts A20 DUB activity leading to dysregulated responses to proinflammatory cytokines and other immune stimuli.  The increased levels of myeloid cells and activated lymphocytes observed in lasvegas mice are consistent with the knockout phenotype (12).  In addition, B cells from lasvegas mice failed to downregulate NF-κB activation and cell proliferation induced by Myd88^L265P, consistent with the negative regulatory role of A20 on NF-κB signaling.

Primers

Primers cannot be located by automatic search.

Genotyping

Las Vegas genotyping is performed by amplifying the region containing the mutation using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification and sequencing:

Primers for PCR amplification:

Las Vegas (F): 5’- GTGCTGAACAAGCTCAAAGTAATCGTC -3’

Las Vegas (R): 5’- TCAGAACTTCGCGCTGTTCCAC -3’

Primers for Sequencing:

Las Vegas_seq (F): 5’- AAGACCTTTTATCACTAGCTCCCAG -3’

Las Vegas_seq (R): 5’- CGGGGTAGGTTTGAAGACTT -3’

PCR program

1) 94°C        2:00

2) 94°C        0:30

3) 57°C        0:30

4) 72°C        1:00

5) repeat steps (2-4) 29x

6) 72°C        7:00

7) 4°C            ∞

The following sequence of 471 nucleotides (from Genbank genomic region: NC_000076.5 of the linear genomic sequence of Tnfaip3) is amplified:

9661                 tcaga acttcgcgct gttccacttg ttaacagaga ccggggtagg     

9721 tttgaagact taaaagttca cttcttgaca gatcctgaga atgagatgaa ggaaaagctt     

9781 ctaaaggagt acttgatagt gatggagatc cctgtgcaag gctgggacca cggcacgact     

9841 cacctgatca acgctgcaaa gtaagcaggc tcctttgacg tgtcctcctg gctggagaac     

9901 ctctcatggt gacaggaagt gcctctcacg agcactggat gtgtcctgtc ataagcctgc     

9961 attttggtgc ttggttatga agttattgcc acgactgcat tgtggaagtg ggttctggga    

10021 gctagtgata aaaggtcttg tgttatttgg ggtcactcat tttcctcttt gttctctaga    

10081 ttggatgaag ctaacttacc caaagaaata aatttggtag acgattactt tgagcttgtt    

10141 cagcac

Complement sequence shown.  PCR primer binding sites are underlined. Sequencing primer binding sites are highlighted; the mutated T is highlighted in red.

References

  1. Wang, J. Q., Jeelall, Y. S., Beutler, B., Horikawa, K., and Goodnow, C. C. (2014) Consequences of the Recurrent MYD88(L265P) Somatic Mutation for B Cell Tolerance. J Exp Med. 211, 413-426.

  2. Vereecke, L., Beyaert, R., and van Loo, G. (2009) The Ubiquitin-Editing Enzyme A20 (TNFAIP3) is a Central Regulator of Immunopathology. Trends Immunol. 30, 383-391.

  3. Verstrepen, L., Verhelst, K., van Loo, G., Carpentier, I., Ley, S. C., and Beyaert, R. (2010) Expression, Biological Activities and Mechanisms of Action of A20 (TNFAIP3). Biochem Pharmacol. 80, 2009-2020.

  4. Hymowitz, S. G., and Wertz, I. E. (2010) A20: From Ubiquitin Editing to Tumour Suppression. Nat Rev Cancer. 10, 332-341.

  5. Makarova, K. S., Aravind, L., and Koonin, E. V. (2000) A Novel Superfamily of Predicted Cysteine Proteases from Eukaryotes, Viruses and Chlamydia Pneumoniae. Trends Biochem Sci. 25, 50-52.

  6. Opipari, A. W.,Jr, Boguski, M. S., and Dixit, V. M. (1990) The A20 cDNA Induced by Tumor Necrosis Factor Alpha Encodes a Novel Type of Zinc Finger Protein. J Biol Chem. 265, 14705-14708.

  7. Tewari, M., Wolf, F. W., Seldin, M. F., O'Shea, K. S., Dixit, V. M., and Turka, L. A. (1995) Lymphoid Expression and Regulation of A20, an Inhibitor of Programmed Cell Death. J Immunol. 154, 1699-1706.

  8. Wertz, I. E., O'Rourke, K. M., Zhou, H., Eby, M., Aravind, L., Seshagiri, S., Wu, P., Wiesmann, C., Baker, R., Boone, D. L., Ma, A., Koonin, E. V., and Dixit, V. M. (2004) De-Ubiquitination and Ubiquitin Ligase Domains of A20 Downregulate NF-kappaB Signalling. Nature. 430, 694-699.

  9. Evans, P. C., Ovaa, H., Hamon, M., Kilshaw, P. J., Hamm, S., Bauer, S., Ploegh, H. L., and Smith, T. S. (2004) Zinc-Finger Protein A20, a Regulator of Inflammation and Cell Survival, has De-Ubiquitinating Activity. Biochem J. 378, 727-734.

  10. Lin, S. C., Chung, J. Y., Lamothe, B., Rajashankar, K., Lu, M., Lo, Y. C., Lam, A. Y., Darnay, B. G., and Wu, H. (2008) Molecular Basis for the Unique Deubiquitinating Activity of the NF-kappaB Inhibitor A20. J Mol Biol. 376, 526-540.

  11. Komander, D., and Barford, D. (2008) Structure of the A20 OTU Domain and Mechanistic Insights into Deubiquitination. Biochem J. 409, 77-85.

  12. Lee, E. G., Boone, D. L., Chai, S., Libby, S. L., Chien, M., Lodolce, J. P., and Ma, A. (2000) Failure to Regulate TNF-Induced NF-kappaB and Cell Death Responses in A20-Deficient Mice. Science. 289, 2350-2354.

  13. Hitotsumatsu, O., Ahmad, R. C., Tavares, R., Wang, M., Philpott, D., Turer, E. E., Lee, B. L., Shiffin, N., Advincula, R., Malynn, B. A., Werts, C., and Ma, A. (2008) The Ubiquitin-Editing Enzyme A20 Restricts Nucleotide-Binding Oligomerization Domain Containing 2-Triggered Signals. Immunity. 28, 381-390.

  14. Boone, D. L., Turer, E. E., Lee, E. G., Ahmad, R. C., Wheeler, M. T., Tsui, C., Hurley, P., Chien, M., Chai, S., Hitotsumatsu, O., McNally, E., Pickart, C., and Ma, A. (2004) The Ubiquitin-Modifying Enzyme A20 is Required for Termination of Toll-Like Receptor Responses. Nat Immunol. 5, 1052-1060.

  15. Turer, E. E., Tavares, R. M., Mortier, E., Hitotsumatsu, O., Advincula, R., Lee, B., Shifrin, N., Malynn, B. A., and Ma, A. (2008) Homeostatic MyD88-Dependent Signals Cause Lethal inflamMation in the Absence of A20. J Exp Med. 205, 451-464.

  16. Duwel, M., Welteke, V., Oeckinghaus, A., Baens, M., Kloo, B., Ferch, U., Darnay, B. G., Ruland, J., Marynen, P., and Krappmann, D. (2009) A20 Negatively Regulates T Cell Receptor Signaling to NF-kappaB by Cleaving Malt1 Ubiquitin Chains. J Immunol. 182, 7718-7728.

  17. Mauro, C., Pacifico, F., Lavorgna, A., Mellone, S., Iannetti, A., Acquaviva, R., Formisano, S., Vito, P., and Leonardi, A. (2006) ABIN-1 Binds to NEMO/IKKgamma and Co-Operates with A20 in Inhibiting NF-kappaB. J Biol Chem. 281, 18482-18488.

  18. Jin, Z., Li, Y., Pitti, R., Lawrence, D., Pham, V. C., Lill, J. R., and Ashkenazi, A. (2009) Cullin3-Based Polyubiquitination and p62-Dependent Aggregation of Caspase-8 Mediate Extrinsic Apoptosis Signaling. Cell. 137, 721-735.

  19. Klinkenberg, M., Van Huffel, S., Heyninck, K., and Beyaert, R. (2001) Functional Redundancy of the Zinc Fingers of A20 for Inhibition of NF-kappaB Activation and Protein-Protein Interactions. FEBS Lett. 498, 93-97.

  20. Zhang, S. Q., Kovalenko, A., Cantarella, G., and Wallach, D. (2000) Recruitment of the IKK Signalosome to the p55 TNF Receptor: RIP and A20 Bind to NEMO (IKKgamma) upon Receptor Stimulation. Immunity. 12, 301-311.

  21. Heyninck, K., De Valck, D., Vanden Berghe, W., Van Criekinge, W., Contreras, R., Fiers, W., Haegeman, G., and Beyaert, R. (1999) The Zinc Finger Protein A20 Inhibits TNF-Induced NF-kappaB-Dependent Gene Expression by Interfering with an RIP- Or TRAF2-Mediated Transactivation Signal and Directly Binds to a Novel NF-kappaB-Inhibiting Protein ABIN. J Cell Biol. 145, 1471-1482.

  22. Heyninck, K., Kreike, M. M., and Beyaert, R. (2003) Structure-Function Analysis of the A20-Binding Inhibitor of NF-Kappa B Activation, ABIN-1. FEBS Lett. 536, 135-140.

  23. Van Huffel, S., Delaei, F., Heyninck, K., De Valck, D., and Beyaert, R. (2001) Identification of a Novel A20-Binding Inhibitor of Nuclear Factor-Kappa B Activation Termed ABIN-2. J Biol Chem. 276, 30216-30223.

  24. Wullaert, A., Verstrepen, L., Van Huffel, S., Adib-Conquy, M., Cornelis, S., Kreike, M., Haegman, M., El Bakkouri, K., Sanders, M., Verhelst, K., Carpentier, I., Cavaillon, J. M., Heyninck, K., and Beyaert, R. (2007) LIND/ABIN-3 is a Novel Lipopolysaccharide-Inducible Inhibitor of NF-kappaB Activation. J Biol Chem. 282, 81-90.

  25. Hu, Y., Baud, V., Oga, T., Kim, K. I., Yoshida, K., and Karin, M. (2001) IKKalpha Controls Formation of the Epidermis Independently of NF-kappaB. Nature. 410, 710-714.

  26. Bohgaki, M., Tsukiyama, T., Nakajima, A., Maruyama, S., Watanabe, M., Koike, T., and Hatakeyama, S. (2008) Involvement of Ymer in Suppression of NF-kappaB Activation by Regulated Interaction with Lysine-63-Linked Polyubiquitin Chain. Biochim Biophys Acta. 1783, 826-837.

  27. Gautheron, J., Pescatore, A., Fusco, F., Esposito, E., Yamaoka, S., Agou, F., Ursini, M. V., and Courtois, G. (2010) Identification of a New Nemo/traf6 Interface Affected in Incontinentia Pigmenti Pathology. Hum Mol Genet. .

  28. Ling, L., and Goeddel, D. V. (2000) T6BP, a TRAF6-Interacting Protein Involved in IL-1 Signaling. Proc Natl Acad Sci U S A. 97, 9567-9572.

  29. Shembade, N., Harhaj, N. S., Liebl, D. J., and Harhaj, E. W. (2007) Essential Role for TAX1BP1 in the Termination of TNF-Alpha-, IL-1- and LPS-Mediated NF-kappaB and JNK Signaling. EMBO J. 26, 3910-3922.

  30. Liu, W. K., Yen, P. F., Chien, C. Y., Fann, M. J., Su, J. Y., and Chou, C. K. (2004) The Inhibitor ABIN-2 Disrupts the Interaction of Receptor-Interacting Protein with the Kinase Subunit IKKgamma to Block Activation of the Transcription Factor NF-kappaB and Potentiate Apoptosis. Biochem J. 378, 867-876.

  31. Song, H. Y., Rothe, M., and Goeddel, D. V. (1996) The Tumor Necrosis Factor-Inducible Zinc Finger Protein A20 Interacts with TRAF1/TBAF2 and Inhibits NF-kappaB Activation. Proc Natl Acad Sci USA. 93, 6721-6725.

  32. Saitoh, T., Yamamoto, M., Miyagishi, M., Taira, K., Nakanishi, M., Fujita, T., Akira, S., Yamamoto, N., and Yamaoka, S. (2005) A20 is a Negative Regulator of IFN Regulatory Factor 3 Signaling. J Immunol. 174, 1507-1512.

  33. Shembade, N., Ma, A., and Harhaj, E. W. (2010) Inhibition of NF-kappaB Signaling by A20 through Disruption of Ubiquitin Enzyme Complexes. Science. 327, 1135-1139.

  34. Bosanac, I., Wertz, I. E., Pan, B., Yu, C., Kusam, S., Lam, C., Phu, L., Phung, Q., Maurer, B., Arnott, D., Kirkpatrick, D. S., Dixit, V. M., and Hymowitz, S. G. (2010) Ubiquitin Binding to A20 ZnF4 is Required for Modulation of NF-kappaB Signaling. Mol Cell. 40, 548-557.

  35. Vincenz, C., and Dixit, V. M. (1996) 14-3-3 Proteins Associate with A20 in an Isoform-Specific Manner and Function both as Chaperone and Adapter Molecules. J Biol Chem. 271, 20029-20034.

  36. De Valck, D., Heyninck, K., Van Criekinge, W., Vandenabeele, P., Fiers, W., and Beyaert, R. (1997) A20 Inhibits NF-kappaB Activation Independently of Binding to 14-3-3 Proteins. Biochem Biophys Res Commun. 238, 590-594.

  37. Lademann, U., Kallunki, T., and Jaattela, M. (2001) A20 Zinc Finger Protein Inhibits TNF-Induced Apoptosis and Stress Response Early in the Signaling Cascades and Independently of Binding to TRAF2 Or 14-3-3 Proteins. Cell Death Differ. 8, 265-272.

  38. Shembade, N., Harhaj, N. S., Parvatiyar, K., Copeland, N. G., Jenkins, N. A., Matesic, L. E., and Harhaj, E. W. (2008) The E3 Ligase Itch Negatively Regulates Inflammatory Signaling Pathways by Controlling the Function of the Ubiquitin-Editing Enzyme A20. Nat Immunol. 9, 254-262.

  39. Shembade, N., Parvatiyar, K., Harhaj, N. S., and Harhaj, E. W. (2009) The Ubiquitin-Editing Enzyme A20 Requires RNF11 to Downregulate NF-kappaB Signalling. EMBO J. 28, 513-522.

  40. Fries, K. L., Miller, W. E., and Raab-Traub, N. (1999) The A20 Protein Interacts with the Epstein-Barr Virus Latent Membrane Protein 1 (LMP1) and Alters the LMP1/TRAF1/TRADD Complex. Virology. 264, 159-166.

  41. Wang, Y. Y., Li, L., Han, K. J., Zhai, Z., and Shu, H. B. (2004) A20 is a Potent Inhibitor of TLR3- and Sendai Virus-Induced Activation of NF-kappaB and ISRE and IFN-Beta Promoter. FEBS Lett. 576, 86-90.

  42. Hutti, J. E., Turk, B. E., Asara, J. M., Ma, A., Cantley, L. C., and Abbott, D. W. (2007) IkappaB Kinase Beta Phosphorylates the K63 Deubiquitinase A20 to Cause Feedback Inhibition of the NF-kappaB Pathway. Mol Cell Biol. 27, 7451-7461.

  43. Coornaert, B., Baens, M., Heyninck, K., Bekaert, T., Haegman, M., Staal, J., Sun, L., Chen, Z. J., Marynen, P., and Beyaert, R. (2008) T Cell Antigen Receptor Stimulation Induces MALT1 Paracaspase-Mediated Cleavage of the NF-kappaB Inhibitor A20. Nat Immunol. 9, 263-271.

  44. Wang, J., Ouyang, Y., Guner, Y., Ford, H. R., and Grishin, A. V. (2009) Ubiquitin-Editing Enzyme A20 Promotes Tolerance to Lipopolysaccharide in Enterocytes. J Immunol. 183, 1384-1392.

  45. Dixit, V. M., Green, S., Sarma, V., Holzman, L. B., Wolf, F. W., O'Rourke, K., Ward, P. A., Prochownik, E. V., and Marks, R. M. (1990) Tumor Necrosis Factor-Alpha Induction of Novel Gene Products in Human Endothelial Cells Including a Macrophage-Specific Chemotaxin. J Biol Chem. 265, 2973-2978.

  46. Krikos, A., Laherty, C. D., and Dixit, V. M. (1992) Transcriptional Activation of the Tumor Necrosis Factor Alpha-Inducible Zinc Finger Protein, A20, is Mediated by Kappa B Elements. J Biol Chem. 267, 17971-17976.

  47. Codd, J. D., Salisbury, J. R., Packham, G., and Nicholson, L. J. (1999) A20 RNA Expression is Associated with Undifferentiated Nasopharyngeal Carcinoma and Poorly Differentiated Head and Neck Squamous Cell Carcinoma. J Pathol. 187, 549-555.

  48. Vendrell, J. A., Ghayad, S., Ben-Larbi, S., Dumontet, C., Mechti, N., and Cohen, P. A. (2007) A20/TNFAIP3, a New Estrogen-Regulated Gene that Confers Tamoxifen Resistance in Breast Cancer Cells. Oncogene. 26, 4656-4667.

  49. Arsenescu, R., Bruno, M. E., Rogier, E. W., Stefka, A. T., McMahan, A. E., Wright, T. B., Nasser, M. S., de Villiers, W. J., and Kaetzel, C. S. (2008) Signature Biomarkers in Crohn's Disease: Toward a Molecular Classification. Mucosal Immunol. 1, 399-411.

  50. Li, L., Hailey, D. W., Soetandyo, N., Li, W., Lippincott-Schwartz, J., Shu, H. B., and Ye, Y. (2008) Localization of A20 to a Lysosome-Associated Compartment and its Role in NFkappaB Signaling. Biochim Biophys Acta. 1783, 1140-1149.

  51. Vallabhapurapu, S., and Karin, M. (2009) Regulation and Function of NF-kappaB Transcription Factors in the Immune System. Annu Rev Immunol. 27, 693-733.

  52. Hayden, M. S., and Ghosh, S. (2008) Shared Principles in NF-kappaB Signaling. Cell. 132, 344-362.

  53. Tergaonkar, V., Correa, R. G., Ikawa, M., and Verma, I. M. (2005) Distinct Roles of IkappaB Proteins in Regulating Constitutive NF-kappaB Activity. Nat Cell Biol. 7, 921-923.

  54. Gerondakis, S., Grumont, R., Gugasyan, R., Wong, L., Isomura, I., Ho, W., and Banerjee, A. (2006) Unravelling the Complexities of the NF-kappaB Signalling Pathway using Mouse Knockout and Transgenic Models. Oncogene. 25, 6781-6799.

  55. Dejardin, E. (2006) The Alternative NF-kappaB Pathway from Biochemistry to Biology: Pitfalls and Promises for Future Drug Development. Biochem Pharmacol. 72, 1161-1179.

  56. Dejardin, E., Droin, N. M., Delhase, M., Haas, E., Cao, Y., Makris, C., Li, Z. W., Karin, M., Ware, C. F., and Green, D. R. (2002) The Lymphotoxin-Beta Receptor Induces Different Patterns of Gene Expression Via Two NF-kappaB Pathways. Immunity. 17, 525-535.

  57. Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krahn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S. C., and Karin, M. (2001) Activation by IKKalpha of a Second, Evolutionary Conserved, NF-Kappa B Signaling Pathway. Science. 293, 1495-1499.

  58. Yilmaz, Z. B., Weih, D. S., Sivakumar, V., and Weih, F. (2003) RelB is Required for Peyer's Patch Development: Differential Regulation of p52-RelB by Lymphotoxin and TNF. EMBO J. 22, 121-130.

  59. Skaug, B., Jiang, X., and Chen, Z. J. (2009) The Role of Ubiquitin in NF-kappaB Regulatory Pathways. Annu Rev Biochem. 78, 769-796.

  60. Stilo, R., Varricchio, E., Liguoro, D., Leonardi, A., and Vito, P. (2008) A20 is a Negative Regulator of BCL10- and CARMA3-Mediated Activation of NF-kappaB. J Cell Sci. 121, 1165-1171.

  61. Li, L., Soetandyo, N., Wang, Q., and Ye, Y. (2009) The Zinc Finger Protein A20 Targets TRAF2 to the Lysosomes for Degradation. Biochim Biophys Acta. 1793, 346-353.

  62. Lin, R., Yang, L., Nakhaei, P., Sun, Q., Sharif-Askari, E., Julkunen, I., and Hiscott, J. (2006) Negative Regulation of the Retinoic Acid-Inducible Gene I-Induced Antiviral State by the Ubiquitin-Editing Protein A20. J Biol Chem. 281, 2095-2103.

  63. Jaattela, M., Mouritzen, H., Elling, F., and Bastholm, L. (1996) A20 Zinc Finger Protein Inhibits TNF and IL-1 Signaling. J Immunol. 156, 1166-1173.

  64. O'Reilly, S. M., and Moynagh, P. N. (2003) Regulation of Toll-Like Receptor 4 Signalling by A20 Zinc Finger Protein. Biochem Biophys Res Commun. 303, 586-593.

  65. Opipari, A. W.,Jr, Hu, H. M., Yabkowitz, R., and Dixit, V. M. (1992) The A20 Zinc Finger Protein Protects Cells from Tumor Necrosis Factor Cytotoxicity. J Biol Chem. 267, 12424-12427.

  66. Daniel, S., Arvelo, M. B., Patel, V. I., Longo, C. R., Shrikhande, G., Shukri, T., Mahiou, J., Sun, D. W., Mottley, C., Grey, S. T., and Ferran, C. (2004) A20 Protects Endothelial Cells from TNF-, Fas-, and NK-Mediated Cell Death by Inhibiting Caspase 8 Activation. Blood. 104, 2376-2384.

  67. Fries, K. L., Miller, W. E., and Raab-Traub, N. (1996) Epstein-Barr Virus Latent Membrane Protein 1 Blocks p53-Mediated Apoptosis through the Induction of the A20 Gene. J Virol. 70, 8653-8659.

  68. Malewicz, M., Zeller, N., Yilmaz, Z. B., and Weih, F. (2003) NF Kappa B Controls the Balance between Fas and Tumor Necrosis Factor Cell Death Pathways during T Cell Receptor-Induced Apoptosis Via the Expression of its Target Gene A20. J Biol Chem. 278, 32825-32833.

  69. Vereecke, L., Sze, M., Mc Guire, C., Rogiers, B., Chu, Y., Schmidt-Supprian, M., Pasparakis, M., Beyaert, R., and van Loo, G. (2010) Enterocyte-Specific A20 Deficiency Sensitizes to Tumor Necrosis Factor-Induced Toxicity and Experimental Colitis. J Exp Med. 207, 1513-1523.

  70. Steinbrecher, K. A., Harmel-Laws, E., Sitcheran, R., and Baldwin, A. S. (2008) Loss of Epithelial RelA Results in Deregulated Intestinal proliferative/apoptotic Homeostasis and Susceptibility to Inflammation. J Immunol. 180, 2588-2599.

  71. Zaph, C., Troy, A. E., Taylor, B. C., Berman-Booty, L. D., Guild, K. J., Du, Y., Yost, E. A., Gruber, A. D., May, M. J., Greten, F. R., Eckmann, L., Karin, M., and Artis, D. (2007) Epithelial-Cell-Intrinsic IKK-Beta Expression Regulates Intestinal Immune Homeostasis. Nature. 446, 552-556.

  72. Nenci, A., Becker, C., Wullaert, A., Gareus, R., van, L. G., Danese, S., Huth, M., Nikolaev, A., Neufert, C., Madison, B., Gumucio, D., Neurath, M. F., and Pasparakis, M. (2007) Epithelial NEMO Links Innate Immunity to Chronic Intestinal Inflammation. Nature. 446, 557-561.

  73. Beg, A. A., Sha, W. C., Bronson, R. T., and Baltimore, D. (1995) Constitutive NF-Kappa B Activation, Enhanced Granulopoiesis, and Neonatal Lethality in I Kappa B Alpha-Deficient Mice. Genes Dev. 9, 2736-2746.

  74. Zetoune, F. S., Murthy, A. R., Shao, Z., Hlaing, T., Zeidler, M. G., Li, Y., and Vincenz, C. (2001) A20 Inhibits NF-Kappa B Activation Downstream of Multiple Map3 Kinases and Interacts with the I Kappa B Signalosome. Cytokine. 15, 282-298.

  75. Tavares, R. M., Turer, E. E., Liu, C. L., Advincula, R., Scapini, P., Rhee, L., Barrera, J., Lowell, C. A., Utz, P. J., Malynn, B. A., and Ma, A. (2010) The Ubiquitin Modifying Enzyme A20 Restricts B Cell Survival and Prevents Autoimmunity. Immunity. 33, 181-191.

  76. Chu, Y., Vahl, J. C., Kumar, D., Heger, K., Bertossi, A., Wojtowicz, E., Soberon, V., Schenten, D., Mack, B., Reutelshofer, M., Beyaert, R., Amann, K., van Loo, G., and Schmidt-Supprian, M. (2010) B Cells Lacking the Tumor Suppressor TNFAIP3/A20 Display Impaired Differentiation, Hyperactivation, Cause Inflammation and Autoimmunity in Aged Mice. Blood. .

  77. Ott, G., Katzenberger, T., Greiner, A., Kalla, J., Rosenwald, A., Heinrich, U., Ott, M. M., and Muller-Hermelink, H. K. (1997) The t(11;18)(q21;q21) Chromosome Translocation is a Frequent and Specific Aberration in Low-Grade but Not High-Grade Malignant Non-Hodgkin's Lymphomas of the Mucosa-Associated Lymphoid Tissue (MALT-) Type. Cancer Res. 57, 3944-3948.

  78. Plenge, R. M., Cotsapas, C., Davies, L., Price, A. L., de Bakker, P. I., Maller, J., Pe'er, I., Burtt, N. P., Blumenstiel, B., DeFelice, M., Parkin, M., Barry, R., Winslow, W., Healy, C., Graham, R. R., Neale, B. M., Izmailova, E., Roubenoff, R., Parker, A. N., Glass, R., Karlson, E. W., Maher, N., Hafler, D. A., Lee, D. M., Seldin, M. F., Remmers, E. F., Lee, A. T., Padyukov, L., Alfredsson, L., Coblyn, J., Weinblatt, M. E., Gabriel, S. B., Purcell, S., Klareskog, L., Gregersen, P. K., Shadick, N. A., Daly, M. J., and Altshuler, D. (2007) Two Independent Alleles at 6q23 Associated with Risk of Rheumatoid Arthritis. Nat Genet. 39, 1477-1482.

  79. Thomson, W., Barton, A., Ke, X., Eyre, S., Hinks, A., Bowes, J., Donn, R., Symmons, D., Hider, S., Bruce, I. N., Wellcome Trust Case Control Consortium, Wilson, A. G., Marinou, I., Morgan, A., Emery, P., YEAR Consortium, Carter, A., Steer, S., Hocking, L., Reid, D. M., Wordsworth, P., Harrison, P., Strachan, D., and Worthington, J. (2007) Rheumatoid Arthritis Association at 6q23. Nat Genet. 39, 1431-1433.

  80. Eldor, R., Yeffet, A., Baum, K., Doviner, V., Amar, D., Ben-Neriah, Y., Christofori, G., Peled, A., Carel, J. C., Boitard, C., Klein, T., Serup, P., Eizirik, D. L., and Melloul, D. (2006) Conditional and Specific NF-kappaB Blockade Protects Pancreatic Beta Cells from Diabetogenic Agents. Proc Natl Acad Sci U S A. 103, 5072-5077.

  81. Grey, S. T., Arvelo, M. B., Hasenkamp, W., Bach, F. H., and Ferran, C. (1999) A20 Inhibits Cytokine-Induced Apoptosis and Nuclear Factor kappaB-Dependent Gene Activation in Islets. J Exp Med. 190, 1135-1146.

  82. Idel, S., Dansky, H. M., and Breslow, J. L. (2003) A20, a Regulator of NFkappaB, Maps to an Atherosclerosis Locus and Differs between Parental Sensitive C57BL/6J and Resistant FVB/N Strains. Proc Natl Acad Sci U S A. 100, 14235-14240.

  83. Wang, H., Kess, D., Lindqvist, A. K., Peters, T., Sindrilaru, A., Wlaschek, M., Blakytny, R., Holmdahl, R., and Scharffetter-Kochanek, K. (2008) A 9-Centimorgan Interval of Chromosome 10 Controls the T Cell-Dependent Psoriasiform Skin Disease and Arthritis in a Murine Psoriasis Model. J Immunol. 180, 5520-5529.