Phenotypic Mutation 'trebia' (pdf version)
Alleletrebia
Mutation Type missense
Chromosome1
Coordinate36,781,025 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539; MGI: 99613

Mapped Yes 
Amino Acid Change Tyrosine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: Y492F

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000027291)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.233) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells - decreased
FACS CD8+ T cells - decreased
hematopoietic competition - disadvantage
immune system
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance unknown 
Alleles Listed at MGI

All alleles(16) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense probably damaging 1.00
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
want_to UTSW 1 36782517 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
zapatos UTSW 1 36771181 missense possibly damaging 0.89
zipper UTSW 1 36770902 missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36778751 missense probably benign
R7704:Zap70 UTSW 1 36779314 critical splice donor site probably null
R7769:Zap70 UTSW 1 36770902 missense probably benign 0.09
R8115:Zap70 UTSW 1 36781206 missense probably damaging 1.00
R8140:Zap70 UTSW 1 36771181 missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36781137 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36779176 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
MMRRC Submission 036191-MU
Last Updated 2019-03-05 6:55 PM by Diantha La Vine
Record Created 2011-02-09 12:19 PM by Owen M. Siggs
Record Posted 2011-08-16
Phenotypic Description

ENU-mutagenized G3 mice were sublethally irradiated and injected intravenously with wild type bone marrow cells (CD45.1+) to create mixed bone marrow chimeras.  The contribution of G3 (CD45.2+) and wild type cells to reconstitution of the hematopoietic compartment was assessed by flow cytometry.  CD4+ and CD8+ T cells from the index trebia mice (siblings J1557 and J1560) were outcompeted by wild type T cells, whereas repopulation of other cell types occurred normally (see figure).  Other non-irradiated mice from the same pedigree had reduced frequencies of T cells, which were CD44hi.

Nature of Mutation

The trebia mutation was mapped by bulk segregation analysis of progeny from intercrosses of (C57BL/10J x C57BL/6J-trebia)F1 mice (n=10 with mutant phenotype, 38 with normal phenotype).  Peak linkage was observed at position 43063842 bp on chromosome 1 (synthetic LOD=6.4).  The candidate gene Zap70 was within the critical region and was directly sequenced, revealing an A to T transversion at position 1566 of the Zap70 mRNA.  The mutation occurs in the tenth of thirteen exons.

 

1550 GCTGACGACAGCTATTACACAGCCCGGTCTGCA

487  -A--D--D--S--Y--Y--T--A--R--S--A-

 

The mutated nucleotide is indicated in red lettering, and causes a tyrosine to phenylalanine substitution at amino acid 492 of Zap70.

Protein Prediction
Figure 1. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The trebia mutation causes a tyrosine to phenylalanine substitution at amino acid 492. The 3D structure is human ZAP70. The trebia mutation is located within the disordered section of the protein in the kinase domain. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Other mutations found in ZAP-70 are noted in red. Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The trebia mutation affects tyrosine 492, one of two tyrosines (Y491 and Y492) in the activation loop of the mouse Zap70 kinase domain.  Phosphorylation of Y492 is required for Zap70 activation (1;2).

 

Please see the record for murdock for more information about Zap70.

Primers Primers cannot be located by automatic search.
Genotyping

Trebia genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers

Trebia (F): 5’- ACTCTGACGCTCACACTCATGC -3’

Trebia (R): 5’-TCATTTTCTGCTCAGGCCAGGGAC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

 

Primers for sequencing

Trebia_seq(F): 5’- GCTCACACTCATGCTATAAAGAAGAG -3’

Trebia_seq(R): 5’- CATGGTGACCCCATAGCTC -3’

 

The following sequence of 761 nucleotides (from Genbank genomic region NC_000067.5 for linear genomic sequence of Zap70, sense strand) is amplified:

 

18732             actctgacg ctcacactca tgctataaag aagagctcct gactctgttt

18781 ccccacgtgc actatggtgg cgatagcagg aactgtgccc agggttcctg taaacattga

18841 acatgtaata aagctcttag catctggcac tgccaacaag gatggtctac atgccagcca

18901 catcactgat gcccaggttt tctacaccca tgccccatgg gaagggagac tgactccacc

18961 atcccctcca ccccagggag gagatccctg tgagcaatgt ggctgaactg ctgcaccagg

19021 tggccatggg catgaagtat ttggaggaga aaaactttgt gcaccgcgac ctggcagccc

19081 gcaatgttct actggtcaat cggcactatg ccaagatcag cgactttggc ctgtccaaag

19141 ccctgggtgc tgacgacagc tattacacag tgagtgccac cccagtggtg cccaggtgga

19201 ggtggctggt gggggagggt tcccaagctc cggtcctagc agttcctccc cgtctcaggc

19261 ccggtctgca gggaagtggc ctctgaagtg gtacgcgcca gagtgcatca actttcggaa

19321 gttctccagc cgcagtgacg tctggagcta tggggtcacc atgtgggagg ccttctccta

19381 tggccagaag ccctacaagg taggctgggc agtttggcaa cggtgggctg gggaggtgga

19441 ccctggctcc tcacacacga atgcctttgt ccctggcctg agcagaaaat ga

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Sara Kalina, Bruce Beutler
Edit History
2011-08-24 12:43 PM (current)
2011-08-24 12:41 PM
2011-08-23 5:41 PM
2011-08-17 10:17 AM
2011-08-17 10:16 AM
2011-08-16 4:35 PM